Identify the various secondary structures in the β1 immunoglobulin-binding domain of protein G (GB1). Is the helix right-handed or left-handed? Is the β-sheets parallel, anti-parallel, or both ? What an elegant protein! - So beautiful. GB1pdb 2LGIRientrstra, C,M,of unknoRight-handedhelixHints:Left-handedC NhelixN -C(a) An antiparallel arrangement of 8 strands.NC-N(b) A parallel arrangement of 8 strands.2010 Pearson Education inc

The secondary structure of the protein predominantly contains the alpha-helix and the beta-sheet. In…

GB1 pdb 2LGI Rientrstra, C,M, of unkno Right-handed helix Hints: Left-handed C N helix N -C (a) An antiparallel arrangement of 8 strands. N C-N (b) A parallel arrangement of 8 strands. 2010 Pearson Education inc

GB1 pdb 2LGI Rientrstra, C,M, of unkno Right-handed helix Hints: Left-handed C N helix N -C (a) An antiparallel arrangement of 8 strands. N C-N (b) A parallel arrangement of 8 strands. 2010 Pearson Education inc

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 9P: Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram...

See similar textbooks

Related questions

Q: In some autoimmune diseases, an individual develops antibodies that recognize cell constituents such…

Q: What are the primary structures of TATA-binding protein (for ex. letter amino acids), What are the…

A: TATA-binding proteins (TBP) bind to Sequences on DNA called TATA boxes. TBP is a general…

Q: Capacity to carry oxygen by sickle cell hemoglobin is reduced due to

A: Sickle cell disease is a group of disorders of blood generally inherited from parents to their…

Q: Describe the structure of IgG in detail by referring to the different levels of protein structure

A: Antibodies are glycoprotein, which has antigen-binding site, each amino acid has different amino…

Q: Amino acid sequence analysis of all of the peptides found in a single IgG antibody would reveal…

A: Antibodies are made of immunoglobulin (Ig) units. They are associated with the immune system and are…

Q: Can you please briefly define these five classes of domain folds.: α, β, α / β, α + β, and…

A: On a larger scale based on α and β secondary structures, the classes of domain folds are:- 1. α: In…

Q: . Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold).…

A: In disulfide linkage, the two cysteine amino acids are joined by a disulfide bond.

Q: The domain of a protien is approximately 350 residues in length. what is length (in A°) of this…

A: Proteins or peptides are the linear chains of amino acid sequences attached via peptide bonds. The…

Q: Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold).…

A: Disulfide bonds are considered the covalent bond, which is formed between the two cysteine residues.…

Q: In BLOSUM62 matrix, a conserved Tryptophan position has score S(W,W) = 11, but a conserved Leucine…

A: BLOSUM is a block substitution matrix that is used to analyze and identify the best possible…

Q: For each of the following sequences determine if they will most likely form an amphipathic α helix,…

A: Proteins are polymers of amino acids. The sequence of amino acids is governed by the sequences of…

Q: give the structure of PNA Sequence and give the 5'-AGCTA-3 Complete Seturaute Structure of…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…

A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…

Q: Each intracellular fusion of a vesicle with a membrane requires a SNARE protein on the vesicle…

A: SNARE protein functions to form vesicles with plasma membrane to form exocytosis. This is common in…

Q: The top side of this figure offers more opportunities (for each base pair) that can lead to highly…

A: A single stranded nucleic acid is formed by joining the nucleotide units together through…

Q: What is the basic recognition motif to which a N-linked glycan is added? A.S/T-X-X B.KDEL…

A: Introduction N-linked Glycosylation (NLG) Is A Complicated Biosynthetic Process That Controls…

Q: 5' UGG CAA UCC UAC GAU 3' < Is it possible for a single base pair substitution to cause a truncation…

A: Yes, it is possible for a single base pair substitution to cause a truncation in the peptide as…

Q: Is the histidine side-chain pKa value higher, lower, or unchanged in an environment surrounded by…

A: Histidine and arginine both are basic residues containing amino groups in their side chain.

Q: A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this…

A: In the normal hemoglobin molecule protein, has a glutamic acid (an amino acid) at the sixth position…

Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…

A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…

Q: How many of the following proteins can interact homophilically (be involved in homophilic…

A: The multicellularity in organisms was achieved only when the cells were able to recognise and attach…

Q: (d) Let's suppose (I'm not saying they are; you figured that out in the question above) that the…

A: The eukaryotic genes are interrupted. The pre-mRNA contains exons and introns. The introns are…

Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…

A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…

Q: The BSA precursor protein is 607 amino acids long and has a molecular weight 69.324 kDa. If a…

A: BSA is globular proteins. 1kDa = 1.66 * 10-21 gm The molecular weight of BSA precursor protein is…

Q: There was a study done (Isabel, et al.) on structural analysis of SARS-CoV-2 spike protein. The…

A: Hydrophobic groups are non-polar. These have a very low affinity with the polar groups. However,…

Q: Shown in the table are partial sequences (coding strand) of the normal human hemoglobin and three…

A: Introduction Hemoglobin, often known as Hb or Hgb, is an iron-containing oxygen-transport…

Q: Shown in the following table are several amino acid substitutionsin the a and b chains of human…

A: Globins are considered an ancient and varied superfamily of proteins. Hemoglobin is an major protein…

Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…

A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…

Q: Identify the following mutations and describe what the possible effect on the protein will be. 5'GAT…

A: 2.1 Mutations are defined as the variations or changes in the DNA which lead to variability in the…

Q: Why is the euchromatic region or light bands in G banding rich in Guanine and cytosine? And why is…

A: euchromatic region or light bands in G banding rich in G C while dark region rich in AT.

Q: 2. coined by Francis Crick? Does SARS-CoV-2 conform to the central dogma of molecular biology that…

A: Note- According to the guidelines only one question can be answered at a time. Please post the other…

Q: If an RNA molecule could form a hairpin with asymmetric internal loop, as shown in Figure Q6–5,…

A: The nucleic acid is a significant macromolecule found in all living organisms. The molecule is…

Q: Which is true of both internal signal-anchor sequences and nuclear localization signals?…

A: Nuclear localization signals (NLS) are generally short peptides that act as a signal fragment that…

Q: Polyglycine, a simple polypeptide, can form a helix with φ = -80°, ψ = +150°. From the Ramachandran…

A: A protein can arrange itself according to requirements. It can be primary, secondary, tertiary and…

Q: and Arg29 is important in determining the structure of the protein. a) What type of amino acid is…

A: This is a question about protein fold and the importance of amino acids in folding.

Q: True or False: An IgM monomer can bind as many as 10 epitopes?

A: ADAPTIVE IMMUNE SYSTEM:- This system is a combination of two:- Lymphocytes and antigen-presenting…

Q: How many Alpha helices and beta sheets are in ESR1? What's the percentage of alpha helices and the…

A: ESR1 is protein coding gene for estrogen receptor. The alpha-helix is right-handed helical coil. 2…

Q: You have discovered a novel protein that has a pl = 5.5. To study the functional properties of this…

A: In this mutation process, hydrophobic phenylalanine is replaced by the Histidine residue. Histidine…

Q: The a chain of eukaryotic hemoglobin is composed of 141 amino acids. What is the minimum number of…

A: There is an intimate connection between genes and synthesis of polypeptides or enzymes. Genes are…

Q: The Hemagglutinin protein in Influenza virus contains a remarkably long a- helix (7.95 nm) with 53…

A: Option H, 14.7

Q: The mutation in hemoglobin at B82 Lys → Asp results in lowered O,-binding affinity compared to…

A: Hemoglobin : It is a protein in your red blood cells that carries oxygen to your body's organs and…

Q: Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation…

A: mRNA is translated to form protein. mRNAs contain trinucleotides sequences that code for particular…

Q: List three factors that do not foster a-helix formation.

A: Proteins are one of the major macromolecules that contain long chains of amino acids. The structure…

Q: 1d) What amino acid would a tRNA with the anticodon 5'AGG³' carry?

A: The amino acids are the fundamental structural unit of proteins. There are 20 amino acids that code…

Q: Where are the Ran-GAP and Ran-GEF proteins predominately located? They are both inside the nucleus…

A: Often certain proteins are seen inside and outside the cell environment that helps in cellular…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Identify the various secondary structures in the β1 immunoglobulin-binding domain of protein G (GB1). Is the helix right-handed or left-handed? Is the β-sheets parallel, anti-parallel, or both ? What an elegant protein! - So beautiful.

GB1
pdb 2LGI
Rientrstra, C,M,
of unkno
Right-handed
helix
Hints:
Left-handed
C N
helix
N -C
(a) An antiparallel arrangement of 8 strands.
N
C-N
(b) A parallel arrangement of 8 strands.
2010 Pearson Education inc

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'?
If I have a DNA sequence of 5’ ATTGGCCGCA 3’, what is the complementary strand?
The sequence of the complementary strand of 5' GTCTATAGAC 3' is_____________ Is there anything special about this sequence?
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
What is the total number of hydrogen bonds that exist between the DNA strand 5’-TTCAGAG-3’ and its complementary strand?
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.
A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?
What is the Strand Length of akubisamengerjakanuts =? Please solve and no reject thank u