Gene DHCR7 Exon1 Intron 1 Expn 2 Intron 2 Exon 3 Construct #1 Construct #2 Intron1 Negative Sel. Intron2 Antibio. Sel Intron1 Intron 2 Antiblo. Sel. Negative Sel. Construct #3 Construct #4 Intron1 Antibio. Sel Negative Sel. Intron2 Negative Sel. Intron1 Antibio. Sel. Intron2

Gene DHCR7 Exon1 Intron 1 Expn 2 Intron 2 Exon 3 Construct #1 Construct #2 Intron1 Negative Sel. Intron2 Antibio. Sel Intron1 Intron 2 Antiblo. Sel. Negative Sel. Construct #3 Construct #4 Intron1 Antibio. Sel Negative Sel. Intron2 Negative Sel. Intron1 Antibio. Sel. Intron2

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Related questions

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5' O5'…

A: Transcription Through the process of transcription, the sequence of DNA gets transformed into the…

Q: it mRNA will be formed from the template strand of DNA? AUGGUGCA at amino acids will this mRNA code…

A: The process by which DNA template synthesizes messenger RNA is called transcription. The other…

Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…

A: Given sequence of EboV strain 1 is CTA TGC AAG CAG TTA and strian 2 is TCA TGT CAG CAA CTA.

Q: GS 42 CI G4 AUG AUG CUC CUC ACG GAC Uuc UAC CGG R (the strand Y CUC GAG AAG The circled structure…

A: The process shown in the image is Translation where with the help of ribosome and tRNA from the mRNA…

Q: Bacteria defend against phages by Natural selection favors mutation can not be recognized by virus.…

A: Bacteriophage is the virus which attacks the bacteria Structure of bacteriophage -- Head --…

Q: OLD DNA NEW DNA mRNA PROTEIN STRAND STRAND NAME REPLICATION TRANSCRIPTION TRANSLATION CGT AGC TGC 1…

A: DNA ( Deoxyribonucleic acid) is a two stranded , helical structure present inside the nucleus of the…

Q: G The gamete that conteins the X + gy com…

A: Central Dogma explains the flow of genetic information. It states that the genetic information is…

Q: What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5'…

A: b. MISSENSE MUTATION

Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…

A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…

Q: 2. What are IC TArE Codon marks theste at wNch translati PART D. Directions: Identify the mutated…

A: In the given question the normal DNA is TAC-CCC- GTC- ACC- GCC- TAT-ATC. The normal RNA formed from…

Q: Writing a Full Strand: 1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT…

A: DNA It is a nucleic acid which carries genetic information that gets passed from one generation to…

Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…

A: Introduction :- Gene expression is the process of formation of response or functional part through a…

Q: Page 6 of 6 Describe the cloning vectors that would be used to clone each of the following DNA…

A: A cloning vector is a short fragment of DNA that allows the incorporation of foreign DNA for…

Q: table opposite shows the standard (coding strand et codes for the 20 amino acids involved in protein…

A: DNA is a nucleic acid.

Q: The DNA strand of an organism living in volcanic vents is likely to be DNA W = 5' GGG GCT AGC CCC…

A: The DNA is made up of four nucleotides. These are Adenine, Thymine, Guanine and Cytosine. A and T…

Q: reerpe om the articte emetically Modified Organism s IMO Tranagenie Crops and Recom binant DNA…

A: Step 1 Plants, animals, fungi, and microorganisms which have been altered by manipulation of their…

Q: Write the 3' to 5' DNA bottom strand • Write the mRNA sequence of top strand Write the mRNA sequence…

A: In DNA there are four nitrogen as base that is adenine, Thymine, guanine and cytosine is present.…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: DNA Repiica TCC cca GTA GAC ATT TTA TTG CCA GTC AAT AAC GcC TTT TTC CAC AGA TAT ACA тот MRNA Strand…

A: DNA is converted into mRNA by transcription. mRNA has the codons, complementary sequence of the DNA…

Q: Select all that apply: Beginning at the 5' end of the DNA, which answer choices place a gene's…

A: Gene or DNA is the basic mode of transfer of inheritance from one organism to another (parents to…

Q: How does the nucleotide sequence of the (+) DNA strand differ from that of the RNA transcript?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: Cise . that the two khotS In rigure аге гегated a sequence of mutations. Figure 2.34 Two nasty…

A: First note that T1T2T3, the closure of the composition of the tangles T1,T2T1,T2 and T3T3, is equal…

Q: 2. If the DNA strand AAA TCG AGG CCA is transcribed to an mRNA, which 2 points shows an occurrence…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…

A: Cells are composed of different components, cell organelles and molecules that are responsible for…

Q: Teminator Promoter Gene (DNA) AUG UA Exon 1 Exon 2 Exon 3 Exon 4 Intron 1 Intron 3 14 Intron 2 15 15…

A: To initiate transcription, RNA polymerase binds to the promoter, so the promoter helps in…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: Which of the following is/are associated with spontaneous mutation?a. An occurrence of lung cancer…

A: Introduction Mutation: any changes in the sequence in the genetic material which lead to disorders…

Q: 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' There are two…

A: Introns are the intervening or noncoding sequence present between the coding sequence.

Q: When does DNA replication occur in the cell cycle? Replicate this strand of DNA: ATTCGC TAG…

A: The cell cycle is a sequence of events before cell division occurs, it prepares cells for division.…

Q: vhat RNA amino acid sequences does the coding strand speciry? Coding strand: Template strand: RNA:…

A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…

Q: 6. What is genetic engineering and why does it work? The ProcessO mokingchanges in the pna Code of…

A: Since, of its simplicity and specificity, gene editing has recently become a trend in genetic…

Q: In test tube 1 (no puromycin) you get a polypeptide that is 90 amino acids long. At least how many…

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC TGA ACT 5' 5 ATG…

A: Mutations are changes in the base pair that can effect the way proteins and mRNA is formed it can…

Q: DNA Template: 5' (?) MRNA (?) 3' 3' GGTCAGATGTGCGCGACGGGCAATCCGCACGTGTCATCAATAGTGCCTTCGTCTGAGATC 5'…

A: DNA subsists inside the nucleus as a double-stranded particle. Some regions of DNA include genes…

Q: (What kind of Genetic Engineering Process (GEP) # 2: process?) Picture A (Sequence #- Picture B…

A: Genetic engineering is a highly debated topic across the world right now as countries are split for…

Q: Transcribe this sequence of DNA into mRNA. 5' ACG AGC TAG CCT 3 3' TGC TCG ATC GGA 5' <- template…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence…

A: The deoxyribonucleic acid (DNA) undergoes the process of transcription for synthesizing the…

Q: In gene therapy, why can't a gene be inserted directly into the cell?

A: Gene Therapy is a molecular biology technique that allows us to correct a faulty gene into normal…

Q: Using the DNA sequence Genetically modified TAC CAG ATA CAC TCC organisms (GMOs)- CCT, create the…

A: A mutation is an alteration in the nucleic acid sequence of a gene encoding a protein. Mutations…

Q: Promotor region of a gene contains start codon and exon one. TRUE OR FASLE ASAP I LL RATE NO…

A: The start codon isn't always placed at the beginning of the first exon.

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical…

A: Codons are made of three nucleotides of DNA or RNA. Each codon codes for an amino acid. The amino…

Q: B. Make identical strands of DNA CCTAT ATCTC TCTAT ATCTC TCATA CTGTG TGTCT CTATA (original) (new) C.…

A: The newly synthesized strand would always be complementary to the original DNA (and with opposite…

Q: DNA: Prokaryote vs Eukaryote DNA found in cytoplasm DNA exists as a single chromosom PROKARYOTE…

A: Cell is the basic structural, functional, and biological unit of all known organisms. The cell…

Q: A few companies in China and South Korea provide theservice of cloning dogs, using cells from their…

A: Cloning is a technique used to create an exact genetic replica or duplicate of another cell, tissue…

Concept explainers

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.

Question

Which of the four constructs (Construct 1-4) could be made to make a knockout mouse? For each one not chosen explain why you did not choose that construct. Antibiotic selection and negative selections are abbreviated)

Gene DHCR7
Exon1
Intron 1
Expn 2
Intron 2
Exon 3
Construct #1
Construct #2
Intron1
Negative Sel.
Intron2
Antíbio. Sel
Intron1
Intron 2
Antiblo. Sel. Negative Sel.
Construct #3
Construct #4
Intran1
Antibio. Sel Negative Sel.
Intron2
Negative Sel.
Intron1
Antibio. Sel.
Intron2

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A set of cells that host various DNA fragments collectively representing an organisms entire set of genetic information is a _________. a. genome b. clone c. genomic library d. GMO
The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. true
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
The main aim of human genome project isa) To identify and sequence of all the genes present in the human bodyb) To introduce new genes to human beingsc) To remove disease causing genes from humansc) To improve techniques of finger printing
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
Here's a line of DNA code: TACACGCCAGAG Transcribe it: (USE caps, no spaces)
The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)
Promotor region of a gene contains start codon and exon one. TRUE OR FASLE ASAP I LL RATE NO EXPLANATION NEEDED
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: