Translate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'

Translate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'

Name: Translate the protein that is expressed from this template DNA sequen
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Translate the protein that is expressed from this template DNA sequence.Transcription is going left to right, the intron is underlined. Codon table isprovided.3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 8QP: The following segment of DNA codes for a protein. The uppercase letters represent exons. The...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGC
Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'
Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’Write: b) the sequence of the corresponding segment of mRNA formed using the DNA segment above as the template
Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT