Q: Why must the gene be inserted into a vector for it to be cloned?
A: Vectors are carriers of target DNA which are readily used in recombinant DNA technology. The most…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: DNa Mapping using Restriction enzymes lab: We will be aliquoting and delivering 5 μl of enzyme to…
A: A restriction enzyme, also known as restriction endonuclease is an enzyme that cleaves DNA into…
Q: Why is this technique used?
A: All cells must synthesize some proteins for their cellular function. The instruction for protein…
Q: Conserved gene order can be termed asa) Orthologb) Syntenyc) Paralogd) Microarray
A: Gene is the functional unit of heredity that consists of DNA (Deoxyribonucleic acid). The DNA…
Q: You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its…
A: As organisms evolve, their DNA and protein sequences change. According to the molecular clock…
Q: 5. What are the Chargaff's rules? Briefly explain by citing an example.
A: According to Watson and Crick , DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure…
Q: Write down all possible outcomes for template ATGCCTAAGTTTCCCTAT sequencing
A: Deoxyribonucleic acid (DNA) is the macromolecule that stores genetic information. It is present in…
Q: DNA microarrays (gene chips) are only capable of monitoring the expression of one gene at a time. O…
A: DNA microarray ( gene chips) are only capable of monitoring the expression of one gene at a time.…
Q: Mapping is the bioinformatics term used to describe alignment of sequence reads to a reference…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: Primer design for SLIC cloning and the protocol
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: What are "genetic biohackers" in reference to "do it yourself CRISPR kits"? Who is Josiah Zayner and…
A: Introduction A genetic biohacker can steal your DNA information and can use it illegally. This…
Q: Using the new sequencing platforms as examples discuss how DNA sequencing technologies have evolved…
A: Dna sequencing g is highly essential for the researchers and the scientists to understand different…
Q: Polymerase chain reaction is commonly used in the laboratory for a) reverse transcription Ob) DNA…
A: In biological and medical research centers, The polymerase chain reaction (PCR) is a frequent…
Q: rue for Sequence tagged site (STS) markers: e mapped by fluorescence in situ hybridization (FISH)…
A: sequence-tagged site (or STS) is a short (200 to 500 base pair) DNA sequence that has a single…
Q: You are cloning a gene from a eukaryotic organism into a plasmid to produce a recombinant protein in…
A: The biological process by which naked DNA (deoxyribonucleic acid) gets transferred from one…
Q: Chromosomal walking is a method of in which researcher begins at a…
A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…
Q: Please ASAP. Thank you. What is the mechanism of action for CRE recombinase in the CRE-loxP system
A: Cre recombinase is tyrosine based enzyme and is derived from P1 bacteriophage. It uses topoisomerase…
Q: Create a 75-nitrogenous base long DNA and replicate it completely. Make sure initiation, elongation…
A: Introduction The process of replicating a double-stranded DNA molecule into two identical DNA…
Q: What is not true for Sequence tagged site (STS) markers: cannot be mapped by fluorescence in situ…
A:
Q: If companies like 23 and me should be allowed to sequence your DNA and give you the results instead…
A: 23andMe is a privately held personal genomics and biotechnology company based in Sunnyvale,…
Q: Molecular Cloning What does molecular cloning mean (with figures/narratives) How does molecular…
A: A) Molecular cloning is a bunch of trial techniques in molecular biology that are utilized to gather…
Q: Using the GeneEx Computer Simulation http://intro.bio.umb.edu/MOOC/jsGX/JsGenex_C2.html Complete the…
A: A gene consists of : Promoter, exons and introns. In the question, we have to create a hypothetical…
Q: in your word, identify one difference one similarity between 16 S sequencing and metagenomic shotgun…
A: With the advancements in science, different techniques have emerged to sequence the genomes of…
Q: 3. Primer Design You are analyzing the
A: Primer is a short stretch of oligonucleotide which is designed to copy the gene sequence of interest…
Q: Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in…
A: Polymerase chain reaction is a method used to make several copies of a specific target DNA.
Q: EXPERIMENT #4: POLYMERASE CHAIN REACTION Purpose: Using PCR technique, amplify the region of…
A: PCR- polymerase chain reaction is defined as the process of amplification of the fragments of the…
Q: 汽 (0 hope this picture, https://www.phys.kSu.edu/gene/photos/sd.html. 2 will help you imagine the…
A: Isolation is a microbiological technique in which individual bacterial colonies are separated from a…
Q: Arslan sequenced a gene in lab how he will know about the gene either it is novel discovery or gene…
A: Different techniques are available to identify genes and classify them as novel. Their…
Q: Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes
A: Directional cloning is the technique which is accomplished by cleaving the plasmid vector with two…
Q: What molecule is next generation sequencing analyzing? DNA, RNA, or protein
A: What is next generation sequencing? It is the process of massive parallel sequencing of DNA…
Q: • High-throughput technologies allow parallel sequencingof millions of individual DNA molecules.…
A: High throughput methods are used in cell biology. Cell biology is a division of biology that deals…
Q: anatomical distribution of gene expression can assessedby...... in situ hybridization rnai…
A: A northern blot is a lab technique for detecting individual RNA molecules in a mixture of RNA…
Q: You have completed an in vitro mutagenesis experiment to create an G to Tmutation in the coding…
A: After first being developed by Frederick Sanger and colleagues in 1977, Sanger sequencing became the…
Q: Of the genes in the microarray shown in the lower part of Figure 20.10, are most overexpressed or…
A: Introduction: Microarray is a technique employed to study the expression of various genes. With the…
Q: CRISPR-Cas9 technology can edit the DNA in random regions True False
A: CRISPR Cas9 technology can edit DNA in precise specific locations and not rand DNA regions. CRISPR…
Q: Genomics and proteomics give us insights into genome function. True False
A:
Q: Im having trouble answering this question. What type of cells can be altered by GETs like CRISPR…
A: The gene therapy or gene editing is an asset for humans, as many of the gene-related disorders can…
Q: Separate the word into their word parts and then define each word part. Mutagen
A: Mutaion is where the DNA or any viral RNA is altered by some external factors which may or may not…
Q: This quarter in lab, you have studied two different technologies that allow genome of a cell:…
A: Scientists have established several methods to edit the genome of a cell. These methods help to make…
Q: You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding…
A: In molecular biology, sequencing is the most important phenomenon in which the the behaviour and…
Q: Which technique/s is/are used in DNA probe development? O CRISPR O ONA profiling OPOR O DNA…
A: PCR Species-specific probes have been developed. For example, specific DNA fragments specific to A.…
Q: What is the program Finch TV used for? Viewing next generation sequencing data O Opening sequencing…
A: There are so many computer application programs used in bioinformatics to read and interpret the…
Q: Create a 75-nitrogenous base long DNA and replicate it completely. Make sure initiation, elongation…
A: Replication of DNA : DNA replication is the process where a new strand exactly similar to the…
Q: You have been given the DNA sequence for a particular fragment of DNA. You then isolated the mRNA…
A: The correct answer is option b. Deoxyribonucleic acid helix is made up of four nitrogenous bases,…
Q: UCSC Genome Browser on D. melanogaster July 2014 (Gene) Assembly (dm3gene) move » >>> zoom in 1.5x…
A: Exons are the coding region and these exons result in the formation of functional protein or enzyme.
Q: advantages of using larger restriction fragments when constructing a genomic library of human DNA
A: DNA library A DNA library is a collection of cloned DNA fragments containing the gene of interest.…
Q: You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding…
A: Introduction :- Sequencing is an process of characterizing sequences of biomolecules , particularly…
Step by step
Solved in 2 steps
- QUESTION 10 Remdesivir is converted in vivo to CMP analog and then phosphorylated to CTP analog. a successful treatment for Ebola. There are more than 1 correct answers in the other choices. a potential chain terminator for the replication of RNA viral genomeQuestion 29 PCR is a technique that: produces information regarding the sequence of nitrogenous bases virtually eliminates operator error from DNA analysis All of these can produce many exact copies of segments of DNA provides a statistical analysis of the nitrogenous-base pairingsQuestion:- Which one is INCORRECT to describe the human genome? Question 16 options: Human genome encodes about 20,000 proteins. None of the human gene has sequence similarity to bacterial genes. Only a small portion (~2%) of the human genome encodes proteins. The size of human genome is smaller than some plants.
- Question Number-1: Using complementary base pairing method, convert the following DNA sequence into RNA sequence. DNA: TACGGCGCGTATACGACTQuestion (1)-Describe the three different methods of horizontal gene transfer among bacteria and mention their significance. Be specific when discussing the donor versus recipient cell, and if the donor and recipient cells are still alive after each horizontal gene transfer event is complete. *Please go into detail if possible on what the donor and recipient cells if they are still alive also after each gene transfer. I have a test coming up that I’m trying to learn all I can about this. Thank you so much!*QUESTION 40 Under what situation would you expect haplotype frequencies to remain unchanged from one generation to the next? a. the recombination rate is zero b. the coefficient of LD is 0.5 c. the two loci are in linkage disequilibrium d. crossing over between two loci occurs regularly
- I need help with question 3, the last image is created I just need it labeled with the derived charactersQuestion 23 Heterochromatin is the part of the DNA where genes are transcribed actively Question 23 options: True False Question 24 Chromatin Immunoprecipitation is used to : Question 24 options: Isolate DNA binding proteins Identify specific sequences bound to Transcription factors Identify a DNA binding peptide Identify high throughput sequenceThe genetic code is identical in cyanobacteria, lions, and humans Question 25 options: True False
- Can you please check my answer and make sure it is correct. Question: How can DNA evidence be used to convict or exonerate a defendant? Why is DNA evidence so powerful? Answer: DNA evidence can be used to perform DNA profiling to determine the genotype of the specific DNA sample. With just a small amount of DNA, PCR can produce billions of copies of that specific segment. The segments that are used are from non-coding regions that contain STR’s or short tandem repeats. These very short DNA sequences are repeated and are specific to individuals because we inherit them from our mother and father. Gel electrophoresis separates the PCR products based on their size and each band is compared to the allele ladder. This process helps to identify the alleles present in the original samples. DNA profiling is performed at many loci to be able to tell the genetic difference between different individuals with a lot of certainty. The DNA from the different suspects is compared to the allele…QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.Question: Some scientists have concluded that this method of gene therapy will be a more effective long-term treatment for SCD than HSCT. Use all the information provided to evaluate this conclusion. I dont know how to answer this question pls help:(