High-copy- number vector Gene Gene inserted into vector 00 Multiple copies of the gene produced FIGURE 9.4 Cloning into a High-Copy-Number Vector When a gene is inserted into a high-copy-number vector, multiple copies of that gene will be present in a single cell, resulting in the synthesis of many molecules of the encoded protein.

High-copy- number vector Gene Gene inserted into vector 00 Multiple copies of the gene produced FIGURE 9.4 Cloning into a High-Copy-Number Vector When a gene is inserted into a high-copy-number vector, multiple copies of that gene will be present in a single cell, resulting in the synthesis of many molecules of the encoded protein.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 9P: Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram...

See similar textbooks

Similar questions

In a bacterial culture in which all cells are unable to synthesizeleucine (leu-), a potent mutagen is added, and the cells areallowed to undergo one round of replication. At that point, samplesare taken, a series of dilutions are made, and the cells areplated on either minimal medium or minimal medium containingleucine. The first culture condition (minimal medium) allowsthe growth of only leu+ cells, while the second culture condition(minimal medium with leucine added) allows growth of all cells.The results of the experiment are as follows: Culture Condition Dilution ColoniesMinimal medium 10-1 18Minimal medium + leucine 10-7 6What is the rate of mutation at the locus associated with leucinebiosynthesis?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.
A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)
Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Nonhomologous end-joining (NHEJ) of a doublestrand break almost always results in perfect resealingof the DNA lesion, without the loss or gain of nucleotide pairs. Yet CRISPR/Cas9, which produces doublestrand breaks, is a highly efficient method of makingsmall deletions or insertions at the targeted site. Howcan you resolve this apparent contradiction?
The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs and is extremely specifi c for its own promoter. Why do these properties make T7 RNAP useful in experiments with recombinant DNA?
An interesting phenomenon found in vertebrate DNAis the existence of pseudogenes, nonfunctional copiesof a gene found elsewhere in the genome. Some pseudogenes appear to have originated as double-strandedDNA copies of mature mRNA inserted into the chromosome; these copies later underwent mutations tomake them into pseudogenes.a. What sequence information might provide cluesthat the original source of some of these pseudogenes is cDNA copied in cells from mRNA andthen inserted into the genome?b. Would this mechanism of generating pseudogenesbe more likely to have operated if the pseudogenewas part of a gene family clustered in one region ofthe genome, or if it was instead part of a genefamily whose members are scattered around thegenome? Explain