Answered: If cytosine (C) makes up 30% of the…

If cytosine (C) makes up 30% of the nucleotides in a gene, what percentage is thymine (T)? O 20% 40% 10% It cannot be determined.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 3QP: If the genetic code used 4 bases at a time, how many amino acids could be encoded?

See similar textbooks

Related questions

Q: What is the name given to study of biochemical nature of genes and how genes express their encoded…

A: Genes are the sequence of nucleotide bases present in the DNA in a cell. There are many genes in the…

Q: A gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.

A: Purines and pyrimidines are chemical molecules that play a role in the production of DNA and RNA and…

Q: E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long?…

A: The genetic code is a sequence of three-letter combinations of nucleotides called codons, each…

Q: To test whether you understand the processes involved in the Central Dogma of Molecular…

A: The synthesis of RNA from the DNA is known as transcription and they synthesis of protein from the…

Q: Explain what happens to the sequence of DNA during trinucleotiderepeat expansion (TNRE). If someone…

A: TNREs are a special kind of mutation, where in a sequence of three nucleotides are repeated (tandem…

Q: Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: HDAC's are important enzymes involved in the regulation of Gene expression. This is because a. They…

A: HAT stands for Histone acetylase. HDAC stands for Histone Deacetylase.

Q: Occurrence of each codon on human transcriptome?

A: Replication, transcription , and translation are the three main processes that cells use to preserve…

Q: You are a researcher who has just discovered a new protein in a fungus. Design a yeast two-hybrid…

A: It is given that a new protein is discovered in the fungus. This new discovered protein interacts…

Q: What is meant by the idea that genes are “immor

A: A gene is the basic physical and functional unit of heredity.Genes are made of DNA.Some genes act as…

Q: α-thalassemia is another blood disorder in which abnormal hemoglobin molecules are formed, leading…

A: A ) Hemoglobin Wayne is an alpha chain variation which shows itself as two minor hemoglobin (Hb)…

Q: • In a ______________, DNA wraps twice around a corecomposed of histones H2A, H2B, H3, and H4.…

A: Chromosomes are the structure in which genes are located. Eukaryotic chromosomes are composed of…

Q: DNA polymerase contains an arginine residue that is important for binding to DNA. Mutations were…

A: DNA polymerase contains an arginine residue that is important for binding to DNA. Mutations were…

Q: σ factors bind to what types of sequences on DNA? a. Shine-Delgarno sequences. b. TATA box…

A: Sigma (σ) factor of RNA polymerase holozyme is a DNA binding promoter that determines transcription…

Q: Imagine that you need to run an experiment that requires you to alter the current genetic make of…

A: Answer: Introduction:To alter genetic makeup of any organism, denaturation is important process…

Q: People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA…

A: The SNP is single-nucleotide polymorphism is a variation of DNA sequence that occurs when single…

Q: n the triplet code, which of the following is true? A. Each DNA base codes for three proteins.…

A: During translation, triplet codon is a set of three nucleotides, which together help to recruit the…

Q: A compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is…

A: The total set of nucleic acid sequences encoded as DNA within the 23 chromosomes is known as the…

Q: Approximately what percentage of the human genome isderived from transposable elements?a. 10%b.…

A: Introduction:- Transposable elements are DNA sequences that have the ability to travel or transfer…

Q: The bisulfite sequencing is different from regular sanger sequencing of nucleotides because…

A: The Sanger sequencing is also known as the chain termination method, it is a method used to…

Q: Which of the following mutations is most likely? a. Cytosine to Adenine b. Guanine to Adenine…

A: When changes occur in our DNA sequence because of several reasons such mistakes while DNA copying…

Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: In human DNA, 80% of in sequences are methylated.A. adenines, ApTB. thymines, ApTC. cytosines, CpGD.…

A: Deoxyribonucleic acid (DNA) methylation is a biological process in which methyl groups are added to…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence is…

Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: Choose the false statement: O Using the experimental design from Griffith's experiments on rough and…

A: The false statement is option b)- The term 'gene' was coined by Griffith to explain what was being…

Q: Pinker mentions that only 1% of the human genome codes for proteins (the rest included introns,…

A: In humans, the complete set of nucleic acid sequences is referred to as the human genome. It is…

Q: The best estimate is that the human genome containsfewer than 21,000 genes. However, there is…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is…

Q: When the human genome sequence was finally completed, scientists were surprised to discover that the…

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give…

A: 1 a) No, there wont be any problem in expressing the two genes. But in bacteria, most of the gene…

Q: A partial amino acid sequence from the tick anti-coagulant protein is:…

A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: In humans, there may be three times as many proteins as genes. If each gene encodes a protein, how…

A: DNA gets condensed to form chromosomes during cell division. Chromosomes are rod shaped chromatin…

Q: If a gene is made up of 26% Adenine, then how much of it is Cytosine?

A: Answer: DNA : Deoxyribonucleic acid which acts as the genetic material, it composed of four nucleic…

Q: How did the work of each of the following scientists—Garrod, Beadle and Tatum, and Pauling—…

A: Gene can be described as the unit of heredity that comprises the information related to the…

Q: You are a researcher studying a gene you think is responsible for super human strength. You call the…

A: The two primers that is the forward primer and the reverse primer gets attached to different ends of…

Q: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense…

A: A missense mutation causes change in a single nucleotide. The resultant codon codes for an amino…

Q: The region of the normal hemoglobin gene used for genetic testing for sickle cell anemia contains a…

A: in sickle cell anaemia [SCA], the RBCs get deformed and lose their biconcave structure which can…

Q: There are about 20,000 human protein-coding genes. Howcan human cells make 75,000–100,000 different…

A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…

Q: What happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?

A: Gene is a stretch of DNA that codes for a particular polypeptide chain.

Q: The following fragment of DNA is from the template strand. First determine the amino acids of the…

A: DNA -> Transcription -> mRNA -> Translation -> Protein Transcription is the synthesis of…

Q: An interesting trait that some bacteria exhibit is resistance to beingkilled by antibiotics. For…

A: In molecular biology, the plasmid is most abundantly used. The plasmid is a circular autonomously…

Q: Examine the following sashimi plot from a transcriptomics experiment. The red peaks mostly RNA STAR…

A: Despite of immense growth in science and technology of sequencing of RNA and DNA, it was challenging…

Q: The human genome contains thousands of sequences known as small open reading frames, some of which…

A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: Nearly _______of the Human GenomeConsists of Transposable Elements?

A: The transposable elements are the DNA sequence that may change its position or location within the…

Q: Answer the following scenario like you are the experts in the field of genetic engineering. Write…

A: Biotechnology refers to the usage of living organisms or their products to create new products or…

Concept explainers

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.

Question

If cytosine (C) makes up 30% of the nucleotides in a gene, what percentage is
thymine (T)?
20%
40%
10%
It cannot be determined.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotife sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
On the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA?
The human genome has approximately 30,000 genes, but human cells can produce over 100,000 different polypeptides. Explain how this is possible
Cap, EA1, and Sap are all genes/proteins of interest in this study. For each gene, what gene product is encoded and where is the gene (the literal DNA sequence) located physically in the cell? I need help fimiding this in the artticle and answer as short as possible https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/
Approximately what percentage of the human genome isderived from transposable elements?a. 10%b. 25%c. 50%d. 75%
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in genetics does this question address?
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?