ity 4 itn the help of the figure below, identify who is the criminal from the two given suspects: A & B. Collect DNA suspect suspect A crime scene evidence Perform PCR on repeats Use gel electrophoresis to identify criminals 12 repeats 16 repeats 12 repeats 12 repeats 12 repeats 16 repeats
Q: What part of the genome is used for a genetic fingerprint? A Introns Ministe OC. Chromosomes OD…
A: DNA fingerprinting is a technique that shows the genetic makeup of living things.
Q: During pcr primers can: become graded by rnases be covslently linked to the template dtrand fall…
A: PCR stands for polymerase chain reaction. It is used to amplify the specific region of gene.
Q: che wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the…
A: Any heritable permanent change in the DNA (deoxyribonucleic acid) sequence is referred to as a…
Q: Put a primer on the top and bottom of bubble at origin. Identify 3’ ends. You can use a thicker line…
A: For DNA replication to occur, following steps take place -
Q: Genetically engineered human insulin, human growth hormone, and human clotting factor VIII are made…
A: Answer is c.) transgenic bacteria.
Q: DNA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once…
A: Gel electrophoresis is considered a molecular technique to separate the DNA fragments as per their…
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: DNA is a hereditary material that is made up of adenine Guanine Cytosine and Thymine. As it is a…
Q: 1505) Y X ERIELLE X Inbox (1 x $ Tyler SIS X t Dietance X student.masteryconnect.com Classroom G…
A: DNA is made up of nucleotides. the sequence of nucleotides is very important because it dictates the…
Q: Sanger Illumina PacBio Amount of DNA needed for sequencing Read length Amount of data sequenced…
A: DNA sequencing DNA sequencing involves various techniques by which the order of nucleic acid…
Q: Okazaki fragments O are short DNA fragments are intermediates in DNA replication begin with a short…
A: Okazaki fragments are a short sequence of DNA nucleotides. The answer is given in step 2.
Q: a.What is the importance of centrifugation in step 3? b.
A: Introduction: For the development of diagnostics and medications as well as for research into the…
Q: t tandem repeats) multiplexing combined with PCR requires a relatively large volume of high quality…
A: Short tandem repeats are a small sequence of nucleotides containing repetitive nucleotides ranging…
Q: You have 15 tubes, each containing 5 ul of DNA (each tube has a different DNA to cut). You want to…
A: A reaction mixture is a combination of 2 or more reactants in definite proportions to carry out a…
Q: DNA is unique for everyone with one exception. What would be an example of that exception?…
A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…
Q: Which of the following ingredients does not belong in a sequencing reaction? ddNTPs Primer © Ligase…
A: Sequencing of DNA The technique to know the exact order of base pairs (nucleotide) in a DNA.
Q: Chromosomal walking is a method of in which researcher begins at a…
A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…
Q: The diagram below shows an autoradiograph ofa DNA sequencing gel. Write the 5' to 3' sequence of the…
A: DNA sequencing is a method used to determine the organism’s actual DNA. The most commonly used DNA…
Q: 5. Below is an image of DNA sequenced using the Sanger sequencing method, where different…
A: Gel electrophoresis is a molecular technique that aims to separate the DNA, RNA, and protein…
Q: DNA saquance of interest DNA of interest Open vector Vector containing DNA of interest -Vector DNA…
A: When a genetically changed vector is injected and integrated into the genome of an organism (host),…
Q: In which direction does DNA replication take place? a. 5-3 b. 3-5' c. 5' d. 3'
A: DNA replication is the process by which two daughter DNA molecules are produced from a parent DNA…
Q: Which of the following best describes the process of DNA seqencing.
A: DNA is mainly made up of the nucleotide and also contains genetic information in the genes. Every…
Q: Pcr primers are: single strand 15-25 bases long incorporated into the newly synthesized DNA…
A: PCR stands for polymerase chain reaction. It is one of the technique of biotechnology.
Q: PGLO plasmid DNA solution with the UV lamp. Note yo observations. Using a micropipetto withdraw 10…
A: pGLO plasmid has GFP as reporter gene. This plasmid is used as vector to carry desired gene of…
Q: 4. Draw the number of fragments as well as their sizes as they would migrate on the electrophoresis…
A: Sal1 is a restriction endonuclease i.e it cleaves DNA at the recognition sequence 5'-G/TCGAC-3'…
Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…
A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…
Q: Gene therapy means to know the sequence of nitrogen bases in all genes True Error
A: The functions of DNA and RNA are controlled by genes. Genes are made up of a distinct collection of…
Q: The southern blot below is the results of a PCR-based paternity test conducted at KNUST forensic lab…
A: The genetic material of an individual is packed in the form of DNA. Shorter nucleotide sequences…
Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…
A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…
Q: To select a different substance, click change in the bottom left corner of the video. Select the new…
A: Proteins are building blocks of life and DNA is the genetic material or blueprint of life. Almost…
Q: 2. The picture shows a segment of DNA from a cat. Which of these is most likely the kitten of this…
A: Dna finger printing is a technique which is used to compare the DNA of two individuals to identify…
Q: Electrophoresis data: Measure the distance (in millimeters) that each fragment traveled from the…
A: Introduction Gel electrophoresis is a laboratory technique for separating DNA, RNA, and protein…
Q: Sticky ends are 1. DNA fragment with single - stranded ends 2. produced by the action of DNA…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: Which of the following statements regarding DNA fingerprinting is false?a) DNA fingerprinting cannot…
A: DNA (deoxyribonucleic acid) profiling or DNA typing is a technique which is used to distinguish…
Q: Which of the following is required in running a PCR reaction? Promoter Primase DNTPS DNA polymerase…
A: PCR is polymerase chain reaction , which is a biotechnology tool used in DNA amplification.
Q: Researchers, troubleshooting PCR, ran their DNA through different temperatures to ascertain when…
A: DNA melting point DNA melting point is the temperature at which the double helix of DNA is meltdown…
Q: our lab is preparing some samples for analysis and loses the labels on the tubes. The samples…
A: A nitrogenous base is a molecule that contains nitrogen and has the chemical properties of a…
Q: Which of these is not a tool for comparing DNA sequences? O PLINK O A dotplot e.g. dotlet O Fasta O…
A: There are different tools in bioinformatics that help in sequencing and comparing the DNA sequences.…
Q: You have discovered a very small amount of DNA from an ancient organism that you want to save and…
A: The DNA (deoxyribonucleic acid) is a molecule found in cells which carries the genetic material…
Q: cDNA, a term used in recombinant DNA technology meansa) Competitive DNAb) Chemical DNAc) Complex…
A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms. DNA contains the instructions…
Q: 2.Fill in the blank with the best answer. If band 3 (6 kB) in lane 5 contains 280 ng of DNA, then…
A: Fill in the blank the question. Average weight of one DNA base pairs= 650 Dalton. 1 Dalton =…
Q: (kbp) (bp) 4. To the right is an image of an agarose gel. Lanes 1 and 4 are DNA markers (DNA sizes…
A: Agarose gel electrophoresis is the process by which DNA fragments are run on the basis of their…
Q: If a police detective finds the tiniest amount of cells at a crime scene, they could produce more…
A: Polymerase chain reaction Hence option(b) is correct.
Q: Use the set of gene sequencing results below to answer the question that follows: A G C T -Wells I…
A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…
Q: If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
A: Question -If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
Q: Which of the following cuts DNA like molecular scissors? Clustered regularly interpaced short…
A: Clustered regularly interspaced short palindromic repeats that are known as CRISPR are family of DNA…
Q: why is recombinant DNA is possible becuase we know dna molecules from all organisms share the same…
A: Yes, it is true that all organisms indeed share the same basic structure of all molecules. But by…
Q: RE the second complementary base from the 5' direction. USE ALL Name the second nucleotide from the…
A: Nucleotides are composed of three components such as a pentose sugar-ribose, a phosphate group, and…
Q: Find the connection among the words below and choose the letter of the word which is different. OA.…
A: Gel documentation (gel doc) or gel imaging systems are used for the analysis of proteins, antibodies…
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA TCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: DNA is a thread-like chain of nucleotides. The order of these nucleotides determines the information…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Please ASAP. Thank you. Regarding the double helix of DNA, which of the following is true? a. Guanine pairs up with cytosine with three hydrogen bonds b. Complementary strands of DNA are held together by covalent bonds c. The backbone consists of ribose sugars H-bonded to phosphate groups d. Uracil pairs up with adenine with two hydrogen bonds1) most STR fragments used in human forensic analysis are comprised of_____ repeatsThe original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
- Provide 3 most applications/purposes of DNA analysis.During electrophoresis, DNA molecules can easily be separatedaccording to size because all DNA molecules have the samecharge–mass ratio and the same shape (long rod). Would youexpect RNA molecules to behave in the same manner as DNAduring electrophoresis? Why or why not?I have this textbook question in my grade 11 bio and it has me really confused as to where to start. Any help would be much appreciated Examine the following DNA sequence and determine what type of mutation, if any, produced the sequences below: ...TAACGCATIT... (a) ...TAGGART... (b) ...TAG CAST... (c) ...TAG CATTLE... (d) ...TACGCA GT TT...
- DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OHWhich student extracted DNA sample(s) contained DNA co-extraction impurities. Provide evidence to support your claim, give examples of such impurities and indicate its potential source.a) what si the nucleotide at the 5 prime end of the picture? b) what si the DNA sequence from 5 prime to 3 prime pls help, urgently required, no explanation needed