Mutated DNA Sequence #1: T A C A C C T T G G G A C G A C T What will be the corresponding mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?

Mutated DNA Sequence #1: T A C A C C T T G G G A C G A C T What will be the corresponding mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?

Name: Mutated DNA Sequence #1: T A C A C C T T G G G A C G A
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Mutated DNA Sequence #1: T A C A C C T T G G G A C G A C T What will be the corresponding mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?
Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this?
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?
Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:
Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in question #6. 5’ ATG GGA GAT TAT TAG 3’ (non-template strand) 3’ TAC CCT CTA ATA ATC 5’ (template strand) What would be the mRNA sequence when this mutated DNA is transcribed? What would be the resulting amino acid sequence when your answer to 7a is translated?
3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence transcribed from template?Amino acid sequence of peptide?and Type of mutation?
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:
Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?
5’-CCTAGACCATAACAT-3’ What happens to the amino acid sequence above as a result of each of the following mutations in the DNA: Substitution of A with T at position 4? Addition of T between positions 8 and 9? Substitution of A with T at position 11? Deletion of A at position 12? Substitution of C with T at position 7? State the type of mutation for each of the base changes indicated.
Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8