Sample Gel Electrophoresis: A brother and sister's DNA are cut with the same restriction enzyme and then the resulting DNA fragments are run on a gel next to each other. DRAW THE BANDS on the gel where they would appear: • Carissa's DNA was cut into 4 pieces: The pieces were 20 base pairs long, 10bp long, 8 and 5. • Christopher's DNA was cut into 5 pieces: They were 25 bp long, 10, 8 and the last two pieces were both 2 bp long. You can make a scale to helo you → 13. What did you do about the 2 DNA fragments that were both 5 base pairs long?. 14. How many DNA fragment sizes do these kids have in common? Carissa Smith Christopher

If a 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one you drew in part a? (PART A WITH THE FIRST PART OF THE QUESTION IS ATTACHED)

Evaluate the gel provided below. Use the notes to help you read the gel: DNA is loaded in the wells (little pockets) at the top. The wells are the dark spaces under the numbers. DNA moves from the wells into the gel. The smaller the DNA the more quickly it moves. The samples on the ends are DNA ladders. We know the sizes of each of those bands and can use them to estimate the size of the DNA in the patient samples. 1 2 3 1: DNA ladder 2: Positive control 3: Patient 1 sample 4: Patient 2 sample 5: Patient 3 sample 6: Negative Control 7: DNA ladder 300 bp 100 bp 1. Why are positive and negative controls needed for PCR (or any test)? 2. Initially, test kits sent out by the CDC were flawed. The negative control sometimes showed up as positive. What misdiagnosis would potentially occur with this mistake? (Over or underdiagnosis?) 3. The CDC ultimately said to use the test anyway. Why might this be the case, given the current situation? 4. How would you evaluate the results above? Do any of…

Above are the results of gel electrophoresis following digestion with restriction enzymes. What is the total length of the DNA fragment?       Which enzyme, HindIII or EcoRI, produced a larger fragment?       What part of DNA causes it to be negatively charged in order for electrophoresis to work?

1 2 Today's technology has made it easier to quickly and accurately generate DNA profiles. In this part of the activity, you will model the process yourself to solve a crime. Good luck, detective! Crime Report: A thief has stolen a priceless collection of jewels from the Museum of Precious Jewels. Forensic technicians obtained skin cells from a forehead print left on the glass enclosure of the jewel exhibit. DNA has been isolated and PCR amplified for some of the standard STR loci. A partial genetic profile generated from the collected DNA is shown in Figure 5. 10 50 DNA Profile from Forehead Print Number of base pairs 00 50 40 D58818 075830 I 16 MU DES1179 Shandand (10) 70 CSF1PO DITS820 80 100 Figure 5. The DNA profile of the forehead print from the scene of the crime. Each colored line shows the alleles for one of four of the core CODIS STR loci (D5S818, CSF1PO, D7S820, D8S1179). and data for the four STR loci that were included in the A suspect was identified in the case. Her DNA…

Three pieces of cut DNA were isolated using gel electrophoresis.The DNA that is the longest will be closest to the positive or negative electrode?

How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT

Number 2, please.

What are some difficulties with low copy number DNA analysis? What kinds of checks and balances can a laboratory employ to ensure reliability of DNA profiles coming from low amounts of DNA template

You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. dNTPs, DNA polymerase and ddCTP were also added. Write out the sequence of 4 DNA fragments you expect to produce in your sequencing reaction. Include the 5' and 3' ends of each fragment in your answer. 3' GACTCGATCGATGATTTCCTCG 5'