Hydrolysis of the N-glycosyl bond between deoxyribose and apurine base in DNA creates an apurinic (AP) site. An AP site ismore thermodynamically destabilizing to a DNA moleculethan is a mismatched base pair.Examine the structure of an AP site.H₂NHNNO™-O-P-O-CH₂GuanineH₂NNHNSelect the chemical consequences that could contribute to DNA instability at AP sites.HH1₂0/Hfewer hydrogen bonds between the unpaired pyrimidine base and waterdisruption of the base-stacking interactionsdecreased interaction between the mutated DNA strand and histonesincreased ability of the deoxyribose ring to open without the attachment of the purine baseHHGuanosine residue(in DNA)O™-O-P-O-CH₂OHH HOApurinic residueHOHH

An apurinic/apyrimidinic site or abasic site can be created as a result of DNA damage or as a part…

Select the chemical consequences that could contribute to DNA instability at AP sites. fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions decreased interaction between the mutated DNA strand and histones increased ability of the deoxyribose ring to open without the attachment of the purine base

Select the chemical consequences that could contribute to DNA instability at AP sites. fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions decreased interaction between the mutated DNA strand and histones increased ability of the deoxyribose ring to open without the attachment of the purine base

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

RNA is ribonucleic acid, and DNA is deoxyribonucleic acid. What exactly is deoxygenated about DNA?
The enzyme ornithine decarboxylase generates a product that has been proposed to play a role in stabilizing compacted DNA. Draw the structure of the ornithine decarboxylase reaction product and explain how it interacts with DNA.
Ethanol promotes bonding between Na+ ions from the salt and charged phosphate group of the DNA due to a higher dielectric constant than water. True or False?
Which conformation of DNA – (i) totally double helix, (ii) minimally unwound or (iii) largely unwound – would have the highest relative absorbance at 260 nm. Would a molecule of DNA having a higher content of guanine and cytosine than of adenine and thymine have a higher or lower melting temperature (Tm) than one with the reverse composition?
Snake venom phosphodiesterase hydrolyzes nucleotides from the 3' end of any oligonucleotide and cleaves between the 3' hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. Which nucleotide would be released first from the oligonucleotide shown below upon treatment with snake venom phosphodiesterase? choices a. Deoxythymidine 5'-monophosphate b. Deoxyguanosine 3'-monophosphate c. Deoxyguanosine 5'-monophosphate d. Guanosine 5'-monophosphate e. Deoxythymidine
A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?
Each group will be provided with 20 g double-stranded DNA oligomer in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4). The sequence of one strand of the oligomer is: 5’-AATGGTACGTATACTTTAT-3’ - show a table of % denaturation of DNA at different temperatures, using the equation provided in “Calculation” - plot a graph of % denaturation of DNA vs different temperatures with clear label and title, and hence determine the experimental Tm of the DNA sample - calculate the theoretical Tm of the sample using Marmur and Doty equation, compare the experimental Tm with theoretical Tm of the DNA sample
The backbone of the DNA molecule is made up of two alternating componebts, what are these? Explain.
Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are negatively charged (e.g., glutamateand aspartate), some are polar but uncharged, and some are nonpolar.If you knew that a DNA-binding protein was recognizingthe DNA backbone rather than a base sequence, which aminoacids in the protein would be good candidates for interacting withthe DNA?
You add 1 ul of EcoRI into 50 ul of your reaction of which contains 10 ug of DNA. How long would it take to completely digest the DNA?
The purine and pyrimidine rings are built from the amino acids aspartate,glutamine, and glycine. Why is serine required for the synthesis of deoxyribonucleotides?
DNA and RNA are chemically very similar but are distinguished, in large part, by the presence of a 2’-OH group in RNA and a 2’-H group in DNA. Why do you suppose that both DNA and RNA have 3’-OH groups and we do not typically find nucleic acids within cells that have 3’-H groups?