Select the pK, values of each functional group observed on the titration curve. 3 0000 I Identify which amino acid is being titrated. alanine aspartate histidine asparagine
Q: The enzyme Lysozyme is present in human nasal mucus and catalyzes the breakdown of a component of…
A: Enzyme kinetics determines the kinetic parameters of enzyme such as the maximum rate of the reaction…
Q: Which of the following is not a type of lipid? Steroids O Glycerides O Enzymes Unsaturated Fatty…
A: 1. Enzymes are not lipids as they are either proteins or RNA. Almost all the enzymes are protein and…
Q: 1. Shown below is the chemical structure for a 5-amino acid pentapeptide. Use this diagram to answer…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Which of the following is a property of both D-altro O They are found in sucrose. O They are major…
A: Monosacharides are the monomers of Polysaccharides that are joined by Glycosidic bonds .…
Q: Which of the following statements are correct of enzymes that are isoenzymes of each other? Choose…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Which of the following are examples of diffusion (either passive or facilitated)? Glucose in the…
A: The process of diffusion is a passive, spontaneous process and occurs down the concentration…
Q: (a) (c) 1/v + inhibitor 1/[S] (b) + inhibitor X 1/v 1/[S] + inhibitor + inhibitor (d) 1/v 1/V I i…
A: Non competitive inhibition is a type of inhibition where the inhibitor binds to a site other than…
Q: Which of the following statements is true for double-stranded DNA? O All of the given choices are…
A: All cellular lifeforms have DNA as their genetic material. A double stranded DNA (dsDNA) is composed…
Q: a) Based only on the proton affinity values, which is the least likely position for initial…
A: Proton affinity value is defined as the negative of enthalpy change (ΔH) of process. Higher the…
Q: Which of the following are properties of membranes? Electrically polarized Hydrophobic exterior…
A: The cell membrane is composed lipid bilayer with proteins embedded in the bilayer. The membrane is…
Q: Which of the following pathways would be considered stage 3 catabolism? (Choose all correct…
A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer only one…
Q: Number 1 question answer. Thank you. no need for a long explanation.
A: Metabolism is a process that involves various enzyme catalyzed biochemical reactions, which…
Q: Which of the following is true about b-amylase? O It breaks the internal alpha-(1---> 6) glycosidic…
A: Introduction: Amylase is an enzyme that degrades starch into sugars. It was first isolated by French…
Q: In an alpha helix, U the peptide chain is fully extended there are hydrogen bonds parallel to the…
A: Amino acids are the building blocks of proteins . They are joined by Peptide bond to form a linear…
Q: Draw the ff. peptides: DK YES CHEM What is the pI of each peptide? Predict the ionic form of the…
A: Peptides are small polymer of amino acids which is linked by peptide/amide (covalent bond). Alpha…
Q: Explain how the lipid bilayer modulate the activity of proteins. Give 2 examples.
A: Lipid bilayer is a bilayer of different types of phospholipids. Plasma membrane is a lipid bilayer…
Q: Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’…
A:
Q: How does the hormone get from its secretory gland to its target tissue? • Are steroid hormones…
A: Since there are multiple questions in the image, I will explain the entire signaling cascade.…
Q: ◆ Arginine Phenylalanine ◆ Cysteine ◆ Serine Glutamic acid ◆ Glutamine ◆ Isoleucine Leucine A.…
A: There are 20 naturally occurring amino acids. In a polypeptide chain, the alpha amino and the alpha…
Q: Which of the following is incorrect about an omega-3 fatty acid whose hydrocarbon chain has only one…
A: Omega-3 fatty acids are defined as polyunsaturated fatty acids (PUFA) which have a double bond…
Q: What property is exhibited by proteins which allows them to absorb large quantities of water?…
A: Proteins are organic molecules composed of amino acids. The polar nature of proteins makes them…
Q: Glutamine is a conservative replacement for asparagine in the primary s mplies that Gln has a…
A: Aspargine and glutamine are amino acids with polar side chain. They are not charged. They have amide…
Q: Differentiate DNA and RNA.
A: Nucleic acids are biomolecules that store, express, and transfer genetic information. A nucleic acid…
Q: Which of the following is incorrect? O a. Metabolic pathways involve mostly intermediates or…
A: Metabolic pathways are very important for a cell to provide energy.metabolic pathways might be…
Q: CRISPR/Cas9 can be used in genome editing. Among the following statements, which one is correct?…
A: Bacteria have evolved various mechanism to resist against the viruses like bacteriophage some of…
Q: What is a protein database? Give examples (and links) of some protein databases.
A: Database is a collection of information that is kept in an organised manner and this is stored in…
Q: Q3. Photodynamic therapy results in induction of WAF1 or CIP1 or P21 leading to cell cycle arrest…
A: Photodynaic therapy is a therapy which involves use of a photo-sensitizing drug or agent (or called…
Q: 2) "I CHz-O-C-CH2(CH2)13CH3 (с CH(CH, ch-o-c-CH2(CH2)13CH3 | 0 II сH2-0 0 -о + OCH,CHÍNH, ||…
A: A saponifiable lipid is are made up of long chain fatty acids that are connected to an alcoholic…
Q: What distinguishes metalloproteins from glycoproteins in particular?
A: Some proteins contain one or more chemical groups(other than amino acids) covalently linked to them.…
Q: Name the nitrogen base component of DNA shown here. (Hint: Name of the particular nitrogen base not…
A: 1. Name the nitrogenous base component of DNA shown here- The given structure is guanine. It is…
Q: What is the relative inhibition of the kinase if the substrate concentration equals Ks And the…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Part II: For the following statement choose (T) for true and (F) for false 1. Animals can synthesize…
A: Introduction: Nitrogen cycle is a continuous process through which nitrogen is converted into many…
Q: Show the order of elution from a cation-exchange resin using a buffer pH of 4.5: aspartic acid,…
A: A cation exchange resin is one that exchanges cations. The resin in this is negatively charged. At a…
Q: Which of the following correctly describes a difference between RNA & DNA polymerases? RNA…
A: Transcription is the biological process of copying a segment of DNA into RNA, for example mRNA that…
Q: so for this biology homework assignment I have to explain why I got this wrong and how to get right…
A: Polymer Macro molecules are the complex structures that are formed by joining together of monomer…
Q: What makes an enzyme stereospecific? Give one example of an enzyme that stereospecific and discuss
A: An enzyme is a protein (or RNA) that can act as a biological catalyst and speed up the rate of…
Q: Which of the following is incorrect about protein kinase A (PKA)? a. It is activated by the 2nd…
A: Introduction: Protein Kinase A is an enzyme present in our cells. It is dependent on the cellular…
Q: Why is fetal hemoglobin’s affinity for O2 greater than that of maternal hemoglobin?
A: Fetal hemoglobin is different than that of the mother's hemoglobin. The affinity of hemoglobin is…
Q: An enzyme is found that catalyzes the reaction: A B A researcher have determined KM and kcat to be 4…
A: Concentration can be expressed in various units like Molar(M) , millimolar (mM) , micromolar (μM) ,…
Q: Which of the following statements is TRUE about fatty acid biosynthesis? Citrate carries malonyl CoA…
A: Triacylglycerol are the triesters of glycerol and fatty acids. Each molecule of glycerol is bonded…
Q: Write down the values in bold print. You are isolating a protein with a pl of 8.5 using cation…
A: As given, protein of interest has pI of 8.5 which was isolated using cation exchange chromatography.…
Q: You obtained the following raw data when setting up a Biuret standard curve: BSA (mg/ml) 0 1 2 3 4 5…
A: Biuret test is a quantitative method to determine the total protein concentration in any unknown…
Q: List ALL of the substrate-level phosphorylation steps in cellular respiration and the enzymes that…
A: Substrate level phosphorylation is the metabolic process by which nucleotide tri phosphate ATP or…
Q: (a) In an experiment to determine the glycine concentration of test sample A, the Ninhydrin method…
A: Absorbance of a solution is directly proportional to its concentration. This is as per Lambert Beer…
Q: After three minutes, the concentration of drug Zip in the red blood cells is 10 mmoles l-1. What is…
A: The rate of reaction is the rate of change of concentration of a reactant or product with time, then…
Q: Starting as a lipid in some holiday prime rib, trace the path that energy and biomass make as that…
A: It is well known to us all that both mass and energy are conserved in the universe. Hence all mass…
Q: 2 When an oxygen molecule binds to the deoxyhemoglobin, multiple conformational changes happen that…
A: Hemoglobin is a protein that carries oxygen from lungs to tissues, and CO2 from tissues to lungs.…
Q: In nucleic Acid Draw/ Illustrate the structures of purines and pyrimidines.
A: Nucleic acids are the polymer of nucleotides. There are two types of nucleotides: de-oxyribo…
Q: there are A-D questions to this picture set up. A) What enzyme catalyzes this reaction? B) What is…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Draw the following: A. a phosphatidylcholine with two oleic acid as the fatty acids B. a…
A: Lipids are structurally diverse biomolecules that have two things in common: low solubility in water…
![Consider the second titration.
0 0 0 0 0 0 0
☐☐☐
PH 100/
| 3
14.0
4
12.0
2
8.0
6.0
Select the pK, values of each functional group observed
on the titration curve.
4.0
2.0
0.0
0.5 1.0 1.5 2.0 2.5 3.0
equivalents of [OH"]
Identify which amino acid is being titrated.
alanine
aspartate
histidine
asparagine](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F43da8127-b8b5-4d0a-8317-0b1da88f2197%2F10f9ad08-ee0d-4f7d-96d6-00a36d1c28b0%2Fbqt4rfd_processed.png&w=3840&q=75)
Step by step
Solved in 2 steps
- Draw a structural formula for each nucleotide and estimate its net charge at pH 7.4, the pH of blood plasma. Q.) 2'-Deoxyguanosine 5'-diphosphate (dGDP)1.2. Using DEAE-cellulose as ion exchange resin, indicate the starting and ending pH for the narrowest experimental pH range used to separate an amino acid mixture consisting of Cys, His and Leu Starting pH: _____ Ending pH: _____Are triacylglycerols : insoluble in water? very oxidized, contain-glycerol-fatty acids and spingosine, or do they possess a -1charge at 7.0 pH? can you select the true statement?
- identify the amino acid described. state the name, one-letter abbreviation, and draw the structure at pH 12.0 a non-polar essential amino acid capable of donating 1 carbon moiety in metabolismWhich reagent(s) would you use for the following processes related to protein chemistry? Write the respective equations. a) Identification of the terminal amino residue. b) Determination of the amino acid sequence of the peptide Gly-Asp-Ala-Cys c) Reversible denaturation of a protein containing disulfide bonds d) Hydrolysis of peptide bonds of aromatic residues of a protein e) Fragmentation of a protein by breaking peptide bonds on the carbonyl side of methionines.For the drug Amlodipine What is one modification could be made to a functional group in order to determine SAR ? Explain why the modification would be useful to determine the SAR.For the drug Amlodipine What is one modification could be made to a functional group in order to determine SAR ? Explain why the modification would be useful to determine the SAR.
- Draw the L enantiomer in a Fischer projection for each amino acid; identify the amino acid as neutral, acidic, or basic. Give the three-letter sign [3], and the one-letter symbol [4].arginine a. arginine b. arginine c. a. glutamic acid b. glutamic acid c. glutamic acidtyrosine b. valine c. arginineExperimental results describing a protein's amino acid composition are useful for estimating the molecular weight (MW) of the entire protein. A quantitative amino acid analysis reveals that bovine cytochrome c contains 6% alanine (?r 89.1) by weight. Calculate the approximate molecular weight of bovine cytochrome c if there are 6 alanine residues. Please enter your answer with three significant figures. approximate bovine cytochrome c MW: Da Bovine chymotrypsinogen has a molecular weight of 25.6 kDa. Amino acid analysis shows that this enzyme is 11% serine (?r 105). Calculate how many serine residues are present in a molecule of bovine chymotrypsinogen. Round your answer to the nearest whole number. number of serine residues:The peptide cys-leu-glu-ala-cys-lys is at pH 7 in oxidizing conditions. Part a) Draw the peptide's titration curve. Part b) What would the pI of the peptide be around?
- What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’A 100 ml solution of 0.1 M amino acid (AA) at ph 1.0 was titrated with NaOH solution. The pH was monitored, and the results were plotted on the graph. The keypoints in the titration are designated I to VII. What is the possible identity of the amino acid? What is the isoelectric point of AA? what is the pKa corresponding to the dissociation of the alpha carboxylic group? Region/point where AA is predominantly present as a (-1) charged species? The effective buffering range for the amino acid in the acidic region? Region/point where the solution has 50:50 percent mixture of the (0) and (-1) speciesExplain the Rf value obtained on the basis of the structure of amino acids use. Explain in 1-3 sentence only.