Q: Briefly explain WHY a 5 7-methylguanosine cap is only added to mRNA, not to tRNA or rRNA. (Please…
A: Introduction DNA is a self replicating molecule. Transcription is a process by which mRNA is…
Q: A couple would like to conceive a child. When should timed intercourse occur? O immediately before…
A: The duration of menstrual cycle is about 28 days. In the menstrual cycle, ovulation generally takes…
Q: Mendelian genetics
A: Biological inheritance: The process of passing of characters from parent to the offspring (i.e.,…
Q: For each of the following statements regarding protein import into mitochondria, indicate whether it…
A: Mitochondria are double-membraned bound organelles seen inside the cell. They are the site of energy…
Q: 5. The electrochemical gradient can be utilised by ATP synthase to generate ATP - explain how the…
A: Photosynthesis - It is a process in which energy from sunlight is transformed into chemical energy…
Q: 3. In the space below, draw a mo transport. Include an example of an appr out in Diffusion out in
A: Human body is dynamic as there is continuous exchange and transport of materials from one cell to…
Q: 23. Use the amino acid chart in your notes to translate the sequence of codons (from #16) and write…
A: In order to write amino acid sequence from a DNA, we have to first write the RNA sequence and then…
Q: There can be more than one correct answer Which of the following methods can seperate proteins…
A: INTRODUCTION All living things require chemicals known as proteins. They are composed of amino…
Q: Speculate about the following details of mitosis. 1. Why do chromosomes need to condense during…
A: MITOSIS The cell duplication is known as mitosis, one cell divides into two genetically identical…
Q: What is the relationship between the structures (tissues and cells) and their location with respect…
A: In plants different types of tissues are found at different locations. These plants perform…
Q: QUESTION 1 The energy for photosynthesis is provided by: A. ATP OB. sound C. light OD. batteries
A: Introduction :- Photosynthesis is the process by which green plants and some other organisms convert…
Q: Explain the Glycemic Index (GI) and how it impacts the digestion of carbohydrates within the human…
A: For foods containing carbohydrates, there is a rating system called the glycaemic index (GI). It…
Q: Give the instructions for preparing a two-fold serial dilution of serum from 0.5 mL serum and using…
A: We are given 0.5 ml saline and 0.5 ml serum. We have to prepare two-fold serial dilution of serum in…
Q: Organism A and B A and C A and D B and C B and D % DNA Hybridization 5-15 5-15 70-90 10-20 2-5
A: Introduction DNA hybridization is a laboratory technique used to determine the degree of similarity…
Q: Why would RNA have the characteristics necessary to function as a ribozyme? What's the deal with the…
A: RNA RNA is Ribonucleic acid. It is one of the nucleic acid that performs essential biological roles…
Q: Activity 3a -Measuring diffusion 1. In this experiment, potassium permanganate diffuses through the…
A: In this experiment, we explored how the concentration gradient affects the rate of diffusion.…
Q: Fill in the blank The ______ acts to position RNA polymerase II for transcription initiation. The…
A: Introduction :- Histones are proteins that play a crucial role in packaging and organizing the DNA…
Q: draw a punnett square, both parents are mixed hybrids, name the 4 possible offspring and the…
A: The above question asks for the construction of a Punnett square, which is a graphical…
Q: Sort the following events to reflect the order in which they should occur during vesicle docking…
A: Answer correct option (b) 3124 Vesicle have bounded Rab-GTP which interacts with Rab effector…
Q: his is an experiment my classmate and I made how the pulse rate would change when putting your hands…
A: Graphs are visual representations of data used to display data linkages and trends. There are…
Q: population of 600 scorpions was split into four populations when irrigation canals were built…
A: When irrigation canals were created across their environment, the population of 600 scorpions was…
Q: Determine the scores and profile number for the strip result table shown bellow
A: The identification of the pathogen is important for the proper treatment of a disease. In order…
Q: Clearly state two important SIMILARITIES in FUNCTION and two important DIFFERENCES in FUNCTION…
A: Immunity is an organism's body's ability to protect itself from non-self infections and maintain…
Q: Replication factor C Proliferating cell nuclear antigen Okazaki fragments DNA Ligase Operans Codon…
A: Introduction Cell division is the process by which a single cell splits into two or more daughter…
Q: Imagine three islands, each with a population of frogs. There are approximately 1,100 frogs on…
A: Due to faults in DNA copying and the natural tendency of sexual reproduction, there is an inbuilt…
Q: 3. What is a correct implication of Chargaff's analysis of base compositions of DNA? Base pairing is…
A: Introduction : Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the…
Q: Nonalcoholic fatty liver disease is thought to be exacerbated by a diet heavy in sugar. Explain?
A: Introduction :- Nonalcoholic fatty liver disease (NAFLD) is a condition in which excess fat…
Q: What structural elements of bacteria are essential, their functions?
A: INTRODUCTION : Bacteria : They are single cellular, microscopic organisms which have the ability to…
Q: 2. A trait in garden peas involves the curling of leaves. A dihybrid cross was made involving a…
A: Introductions:- A dihybrid cross is a genetic experiment in which the inheritance of two contrasting…
Q: 35. Which of the following occur during processing of pre-mRNA? a.) removal of exons b.) removal of…
A: The process of transcription takes place in nucleus,in which mRNA is synthesised from the…
Q: Required information View the animation below, then complete the quiz to test your knowledge of the…
A: Introduction Simple diffusion is a process that occurs without the use of energy or specialized…
Q: Trade secret protection can be an effective strategy in an environment where patent protection is…
A: A patent can protect inventions, innovations. Trade secret protection confers owners the right to…
Q: The make-up of the microbial community in the leaves of pitcher plants is affected more by the types…
A: Introduction: Adaptations refer to the characteristic features and behaviors that have evolved in a…
Q: A sheep breeder has a sheep that is large (L) with soft wool (S). The breeder conducts a testcross…
A: Introduction : A test cross is defined as the cross between an individual with an unknown dominant…
Q: 5. Deficiency of gene 5 expression leads to duplex kidney phenotype. Determine genotype(s) of mice…
A: Gene expression means to form a protein by a particular DNA sequence. It is a lengthy process which…
Q: Draw the three different cell junctions, and explain how the structure of one of these junctions…
A: In tissues, cells are connected to one another via cell-cell junctions, which also control tissue…
Q: Gram-negative bacteria are not killed by penicillin because they: do not have ribosomes.…
A: Bacteria can be gram-positive or gram-negative depending on how they are stained. Christian Gram…
Q: What macronutrient provides the most calories in this product? b. Is this product considered any…
A: Nutrients are organic molecules necessary for the survival of biological cells. Based on the amounts…
Q: Some studies have shown that cholesterol plays an important role in the entry of SARS-CoV-2 into…
A: Introduction COVID-19 is a disease caused by the novel coronavirus that first emerged in late 2019…
Q: Malignant hyperthermia More than one answer mayy be correct. Question 8 options: can by…
A: Malignant hyperthermia is a genetic disorder which follows autosomal dominant inheritance pattern.…
Q: A child weighs 11 kilograms. The health care provider orders a drug as follows: 0.2 mg/kg…
A: Drugs can be administered orally, intravenously, intramuscularly, subcutaneously route, rectal,…
Q: 5) Humans who have an abnormally high level of cholesterol are said to suffer from familial…
A: Introduction :- Familial hypercholesterolemia is an inherited disorder characterized by elevated…
Q: explain how the deletion of the same set of genes can result in such different diseases. The example…
A: Imprinting is an epigenetic phenomenon connected to Prader-willi syndrome (PWS). A foetus typically…
Q: Genetic counseling for prospective parents is often considered for couples who are from different…
A: INTRODUCTION Genetic counseling is a process that helps individuals and families understand and…
Q: Explain why the phenotypic frequency of the tuskless trait is increasing in the African elephant…
A: The change in the character of an organism over generations is called evolution. The evolution of…
Q: 7. In the binomial naming system, scientific names are written in italics, with the first word…
A: Introduction : A species is classified and named using the binominal nomenclature system, which…
Q: Dr. Thompson learned in her university genetics course to memorize probability outcomes from…
A: The inheritance is encoded by two genes. These are M and N genes. M gene has two alleles. These are…
Q: Describe how changes in the ladybugs'environment may influence their survival and/or reproduction.
A: Ladybugs belong to the phylum arthropods and are natural killers for many herbivorous insects. They…
Q: Which of these endocrine cells are also target cells for other hormones? (choose the most inclusive…
A: Introduction : The endocrine glands in the body produce hormones, which are unique chemical…
Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…
A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…
Step by step
Solved in 3 steps with 1 images
- DNA Profiles as Tools for Identification A PCR-based paternity test is conducted using STRs that consistently produce a unique DNA fragment pattern from a single chromosome. Examining the results of the following Southern blot, which male(s) can be excluded as the father of the child? Which male(s) could be the father of the child?Functional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA polymerases fall into the Y family of DNA polymerases. Structural studies reveal that their fingers and thumb domains are small and stubby (see Figure 28.10). In addition, Y-family polymerase active sites are more open and less constrained where base pairing leads to selection of a dNTP substrate for the polymerase reaction. Discuss the relevance of these structural differences. Would you expect Y-family polymerases to have 3-exonuclease activity? Explain your answer.Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
- Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.)Please help C. Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?Mustard gas is an extremely toxic substance that severelydamages lung tissue when inhaled in large amounts. In smallamounts, mustard gas is a mutagen and carcinogen. Considering that mustard gas is a bifunctional alkylating agent, explain how it mutates genes and impacts DNA replication.
- Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?Mutation: Thiamine Dimers A. what is a mutagen or cellular process that leads to this mutation? B. If the nucleotide excision repair pathway is not functional, is there another pathway or mechanism for preparing this mutation? if so, what is the pathway/mechanism? C. what is the consequence of this mutation if it is not repaired before DNA is replicated to make the next generation of cells?Preparing plasmid DNA (double stranded, circular) for Sanger sequencing involves annealing a complementary, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90°C and then slowly bringing the temperature down to 25°C. Why does this protocol work? What enzyme is used and what other components are required in the sequencing reaction? How does the Sanger method determine the sequence?
- During electrophoresis, DNA molecules can easily be separatedaccording to size because all DNA molecules have the samecharge–mass ratio and the same shape (long rod). Would youexpect RNA molecules to behave in the same manner as DNAduring electrophoresis? Why or why not?Not just generic "degradation" or even shorter DNA fragments, what specific structure change in double-stranded DNA does the hyperchromicity effect show?Task A: Polymerase Chain Reaction Master Mix Your first task is to isolate and amplify the NRAS gene from cDNA extracted from different samples through PCR. You will need to run a total of 7 PCRs: 3 normal samples, 3 cancerous samples, and 1 negative control. To make things easier in the lab, when running multiple reactions, the components are prepared not individually, but as a master mix—all the components for multiple reactions are prepared in bulk, except for the template DNA, which is added separately once the master mix has been distributed into individual tubes. The table below lists the different components for PCR, the available stock concentrations of these components, and the needed working concentrations for the PCR itself. Complete the table by supplying the needed volumes of each component for a single reaction and for the master mix (the first row has been filled in as an example).