10. Protein expression can be blocked by antisense oligonucleotides. Whichmechanism enables antisense oligonucleotides to block protein synthesis?O Antisense oligonucleotides bind to ribosomes and inhibit their function.Antisense oligonucleotides bind to DNA in the nucleus and inhibit the synthesis oMRNA.Antisense oligonucleotides bind to ribosomal RNA (rRNA) and inhibit ribosomeassembly.Antisense oligonucleotides bind to messenger RNA (MRNA) and prevents mRNAbinding to ribosomes.

Antisense oligonucleotides bind to messenger RNA (mRNA) and prevents mRNA binding to ribosomes to…

Answered: 10. Protein expression can be blocked…

10. Protein expression can be blocked by antisense oligonucleotides. Which mechanism enables antisense oligonucleotides to block protein synthesis?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Related questions

Q: 1. What is the effect of RNAI on gene expression? A. Knock out B. Knock down C. Knock up D. Knock in

A: RNAi means RNA interference which is a biological process in which miRNA / siRNA neutralizes the…

Q: 7) Describe in detail the mechanism by which the major spliceosome removes introns from pre-mRNA…

A: Spliceosome is a complex small nuclear RNA protein molecule also called snRNA that helps to remove…

Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)

A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…

Q: Although DNA gets all the glory, it’s actually RNA that does most of the work when cells produce…

A: In species, gene expression is a vital and essential process that helps to produce proteins by using…

Q: 4. What is the use of miRNAs in the cell? Please discuss the effect of a mutant Argonaute protein on…

A: RNA (ribonucleic acid) is a polymer of nucleotides that is composed of pentose sugar, a nitrogen…

Q: 20. Fill in this table with the effects that this mutation would have on mRNA and protein sequence…

A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…

Q: 5. How will F-2,6-BP levels and flux through gluconeogenesis be affected in the liver of patients…

A: According to the question, patients with a form of early-onset diabetes were found to carry a…

Q: 8. Label each figure with what TYPE OF CELL is undergoing gene expression: Nuclear membrane DNA…

A: Gene expression is a process in which first transcription occurs that is formation of RNA occurs…

Q: 29) Which one of the following statements about RNA processing is correct? A) Exons are cut out…

A: The term DNA stands for deoxyribonucleic acid. Deoxyribonucleic acid is the most important…

Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…

Q: 5. A molecule with three bases on one end that can bind an amino acid on the other end during ge…

A: The central dogma is a vital process that is responsible for deducing the flow of genetic…

Q: Why aren't ssb proteins necessary in transcription?

A: The function of SSB protein is to prevent the recoiling of parent strands during replication. As we…

Q: 1. What are the types and major functions for each type of RNA?

A: NOTE: Since you have asked multiple question, we will solve the first question for you. If you…

Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…

A: Need to find which of the following is correct regarding RNA polymerase function.

Q: .Describe the process of transcription in prokaryotes, then explain how proteins can be targeted for…

A: The bacterial genome is comprised of circular DNA present in the cytoplasm and does not have…

Q: which does not play a role in translation?

A: The translation is the process in which the message coded by an mRNA is translated into a sequence…

Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…

A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions…

Q: 5) The bacterial Lac operon is an example of transcriptional regulation. What are the major…

A: Using an example of Escherichia coli for the bacterial lac operon. Escherichia coli is a…

Q: 1. What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…

A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…

Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…

A: "Transcription" and "Translation" are two important processes that take place inside the cell for…

Q: 5. The lacl gene is only transcribed when both glucose and lactose are present. True or False.

A: Gene regulation at the level of transcription in bacteria is achieved by the operon model. Operon…

Q: iii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…

A: Promoter sequence is present in the DNA at the upstream of regulatory gene.

Q: the two factors that bind directly to the DNA at specific sequences are TFID and TFIIB, in genreal…

A: Transcription is the process by which the information in a strand of DNA is copied into a new…

Q: A life-form from another universe is found to have nucleic acid which includes six different bases -…

A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…

Q: 7. Explain the cyclin-dependent kinases, completely. 8. Describe DNA ALKYLATING AGENTS.

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: 1. What happen to the mutated sequence in the coding region of MT-ATP6 in Leigh's syndrome. Does it…

A: Leigh's syndrome is a rare neurogenetic disorder that affects the central nervous system. The…

Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: 1. What is meant by the term ‘redundancy’ in the context of the genetic code? b) What are the…

A: Answer: DNA sequence is the sequence of nucleic bases arranged in an order which can able to read…

Q: What are the different types of RNA and their contributions to the process of Protein Synthesis?

A: a. messenger RNA (mRNA) b. ribosomal RNA (rRNA) c. transfer RNA (tRNA)

Q: 3. How do we know that expression of the information encoded in DNA involves an RNA intermediate?

A: DNA or Deoxyribonucleic acid is the genetic material found in all living organisms. DNA is a double…

Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?

A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…

Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…

A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…

Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…

A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…

Q: 9. What is the role ol RNA polymerase? To answer the question please: 1) name three types of RNA in…

A: RNA: It is made up of repeating strands of nucleotides which contain all the three parts (nitrogen…

Q: 2. Which one of the following statements is TRUE of bacterial transcription? A. It produces pre-mRNA…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 3. What is meant by the term histone code? With regard to gene regulation, what is the proposed role…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 4) RNAI is the name used to describe a system that cells use to shut down the translation of…

A: ANSWER;- RNAi is mainly of two types: small interfering RNA(siRNA)- which are made artificially or…

Q: 3.explain why the following statement is false. "Interaction of specific transcription factors and…

A: Note: Since you have posted multiple independent questions in the same request, we will solve the…

Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…

A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…

Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…

A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…

Q: 1. What happens during transcription? Possible sentence frame: Transcription is the process in which…

A: Need to fill the blanks related to transcription process.

Q: 1) Transcription and translation both involve an initiation, elongation, and termination phase.…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: 8. Which of the following is NOT an example of an epigenetic mechanism? A) DNA methylation B)…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: How is a protein made inside the cell, from the very start until when it is shaped and packaged?

A: Proteins are an important biomolecule made up of long chains of amino acids. They are important for…

Q: 1. The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…

A: Answer:- The process in which the peptide bonds formation occur in between the ribosome called…

Q: 1) The direction of transfer of genetic information in all living things (as defined in the central…

A: it is the process of conversion of the DNA into the functional product it explains how genetic…

Q: Protein synthesis, begins with a process known as pre-initiation. Explain three scenarios that would…

A: Initiation factors are proteins binding to the smaller subunit of the ribosome during the initiation…

Question

100%

10. Protein expression can be blocked by antisense oligonucleotides. Which
mechanism enables antisense oligonucleotides to block protein synthesis?
O Antisense oligonucleotides bind to ribosomes and inhibit their function.
Antisense oligonucleotides bind to DNA in the nucleus and inhibit the synthesis o
MRNA.
Antisense oligonucleotides bind to ribosomal RNA (rRNA) and inhibit ribosome
assembly.
Antisense oligonucleotides bind to messenger RNA (MRNA) and prevents mRNA
binding to ribosomes.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Answer:

VIEW

Explanation:

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
What property prevents the ligands of cell-surface receptors from entering the cell? The molecules bind to the extracellular domain. The molecules are hydrophilic and cannot penetrate the hydrophobic inferior of the plasma membrane. The molecules are attached to transport proteins that deliver them through the bloodstream to target cells. The ligands are able to penetrate the membrane and directly influence gene expression upon receptor binding.
1. What is the central dogma? What are the compounds involved in this process? (Keywords: transcription of DNA to RNA, translation of RNA to proteins; gene expression)
3. Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
7. Although DNA gets all the glory, it’s actually RNA that does most of the work when cells produce proteins. Explain how RNA is involved in gene expression (i.e., in transcription and translation).
1. Why is RNA necessary to act as a messenger? Why can't the code be taken directly from the DNA? How do some cells become brain cells and others become skin cells, when the DNA in ALL the cells is exactly the same? In other words, if the instructions are exactly the same, how does one cell become a brain cell and another a skin cell?
A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)
18) which of the following statements is correct? A proteins make MRNA which then makes genes B genes make proteins which then make mRNA C genes make mRNA which then make proteins d- MRNA is make proteins which then make genes E- MRNAs make genes which then make proteins
3. translate the following sequence of messenger RNA nucleotides in a sequence of amino acids forming part of a polypeptide chain a. C-U-G-U-U-U-U-G-C-A-G-U-G-G-U-U b. write the sequence of nucleotides for the portion of a DNA molecule that served as a pattern or template for the formation of the messenger RNA above. c. A certain protein contains the following sequence of amino acids: isoleucine-serine-arginine-glutamic acid-serine-proline-valine-glutamic acid. Using the table found in your text, write the sequence of RNA triplet that would code for this sequence of amino acids. then write the sequence of DNA triplets that would code for the formation of RNA
5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
1) Below are some events that occur in the process of translating mRNA into a protein in a bacterial cell. Pick the best order of events. EF-G–GTP binds to the tRNA in the A site and causes the tRNA to advance to the P site.- The rRNA in the ribosomal 30S subunit base-pairs with the Shine-Dalgarno sequence in the mRNA.- Peptide bond forms between the growing amino acid chain in the P site and the new amino acid in the A site.- IF-3 binds in the E site.- RRF binds in the A site.- RF-1 or -2 binds in the A site.- Ribosomal complex dissociates.- Peptide chain dissociates from final tRNA.- fMET tRNA binds to the start codon in the mRNA.- RF-3–GTP causes displacement of RF-1 or -2 and its exit from the ribosome.- EF-G–GTP binds to the A site and causes RRF to shift to the P site.- A conformational change in the 30S subunit allows the 50S subunit to bind, forming the 70S ribosome. Step 1, 2, 3, 4 ,5 ,6 , 7, 8, 9, 10, 11, 12