STEP 1 YFP Trarsfect into ouilts STEP 2 Epitope-tagged protain (ancoded by eDNA) STEP 3 Lyse calls YFP Competitive eluion with peptide encoding the epitope YFP Gel elactrophoresis A YFP A B STEP 5 STEP 6 Afinty-based purification uang immobilized artibody against the epitape STEP 4 Excise bands end analyze by mass spactrometry STEP 7

STEP 1 YFP Trarsfect into ouilts STEP 2 Epitope-tagged protain (ancoded by eDNA) STEP 3 Lyse calls YFP Competitive eluion with peptide encoding the epitope YFP Gel elactrophoresis A YFP A B STEP 5 STEP 6 Afinty-based purification uang immobilized artibody against the epitape STEP 4 Excise bands end analyze by mass spactrometry STEP 7

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 5DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
You overexpressed (asked bacteria to make a lot of) an 80 kDa protein carrying a 6X-His tag and purified it on a nickel column. You collect frac ons from your purifica on and analyze them using SDSPAGE. The results are shown in image attached. a) Interpret the results from the gel. What is wrong? (see image attached) b) Identify 2 possible reasons why this problem is occurring, and for each reason, suggest an experimental modifica on you can do to troubleshoot.
Attached is an image of EcoRI-digested plasmid samples (pBSK and pEMBL1.9); explain why the bands are found at the top, the purity of the results, and how we couple improve our results.
A protein gives a single band on SDS gel electrophoresis, as shown in lanes 1 and 2 below. There is little, if any, effect from adding β-mercaptoethanol(BME) to the sample; if anything, the protein runs a little bit slower. When treated with the proteolytic enzyme thrombin and electrophoresis in the absence of BME, the protein migrates a bit more rapidly (lane 3). But if BME is present, two much more rapidly migrating bands are found (lane 4). Explain these results in terms of a model for the protein.
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Experiment: Bradford protein assaygive the answers (4-5 lines) of review questions in the end. the answer should be logical and understandable and without plagiarism. avoid copy-pasting. PLEASE GIVE THE ANSWER OF 3rd AND 4th QUESTION. ITS COMPULSORY.Background information:The Bradford assay is very fast and uses about the same amount of protein as the Lowry assay. It is fairly accurate and samples that are out of range can be retested within minutes. The Bradford is recommended for general use, especially for determining protein content of cell fractions and assessing protein concentrations for gel electrophoresis. The method described below is for a 100 µl sample volume using 5 ml color reagent. It is sensitive to about 5 to 200 micrograms protein, depending on the dye quality. In assays using 5 ml color reagent prepared in lab, the sensitive range is closer to 5 to 100 µg protein. Scale down the volume for the "micro assay procedure," which uses 1 ml cuvettes. Protocols, including…
Compare and contrast the principle behind DNA migration in agarose gel electrophoresis from that of protein migration in SDS-PAGE.
83. A plasmid is cut with the restriction enzyme BamH1 giving fragments of 3000 and 1000 bp as identifiedby gel electrophoresis and ethidium bromide staining. In a seperate restriction digest the enzyme EcoR1gives fragments of 1000 and 1500 bp that are apparent on the agarose gel. What is the most likely size ofthe plasmid in bp? Explain why it's 4000