2 I need help with the Biochemistry problembelow. I upvote all correct answers anddownvote if its incorrect. Thank you inadvance!The dissociation constant for a particular repressor-operator complex is very low, about 10-19 M. An E. coli cel (volume2 x 10-12 mL) contains 10 copies of the repressor.Calculate the cellular concentration of the repressor protein.x10repressor protein concentration:How does this value compare with the dissociation constant of the repressor-operator complex?O The repressor protein concentration is about 10 times greater than the dissociation constant.The repressor protein concentration is about 10-20 times lower than the dissociation constant.The repressor protein concentration is about 10s times lower than the dissociation constant.O The repressor protein concentration is about 10 times greater than the dissociation constant.

In the question, Volume of cell = 2x10-12 ml = 2x10-15 Liter Number of repressor molecule in one…

Answered: The dissociation constant for a…

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 10TYK

See similar textbooks

Similar questions

Yes or no? reverse genetics is RNA interference example. cellular differentiation potency in multipotent is greater than pluripotent stem cell. does digoxigenin UTO use to make dsrna and perform rna interference?
Hi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequence
Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…
1) Antibiotic-resistance is one of the gravest dangers to the world’s medical system. As a result, Dr. Jhon Peῆa decides to apply for a research grant from the NIH to investigate novel targets for antibiotic treatment in his lab. Most bacteria have developed resistance to counter the effects of the current crop of antibiotics, which largely target the cell wall, plasma membrane, or ribosomes. Dr. Peῆa’s team has instead been investigating bacterial transcriptional sites and all of his students are asked to attend a group Zoom meeting to discuss ideas to put into the grant. The lab technician, Jazmin, wonders if anyone thought of blocking the entrance way to the ribosome, the translator of mRNA? What does the rest of the lab think? a Considering the grant is for transcriptional targets, this makes no sense. b This makes perfect sense since the bacterial ribosome has a different structure than the eukaryotic ribosome, which everyone learns in Intro Bio in their…
PLEASE HELP ME ANSWER THESE OBJECTIVES QUESTIONS. THANK YOU IN ADVANCE. 1. In genetic engineering, a reverse transcriptase enzyme is used to a. replace the Pfu polymerase enzyme b. denature all messenger RNAs c. undo the action of a restriction enzyme d. produce complementary DNA 2. In lac operon, both gene A and gene B undergo a transcription process. Gene B can only undergo transcription in the presence of lactose and in the absence of glucose. The product of gene A is often altered by an inducer. Which of the following is true about genes A and B? a. Gene A= structural gene; Gene B= regulatory gene b. Gene A= promoter gene; Gene B= operator gene c. Gene A= lacZ gene; Gene B= promoter gene d. Gene A= regulatory gene; Gene B= structural gene 3. In response to a newly encountered pathogen, the first antibody class to appear in the serum is ________. a. IgE b. IgM c. IgA d. IgG 4. Lymphocytes that involve in the defense system by means of direct attack…
Please answer fast Consider that sequencing identifies the grumpy gene in your Illumina $1200 personalized genome. Which of the following would you want to hear from your genetic counselor? A. It lacks a promoter sequence. B. It has an early STOP mutation. C. I would want to hear all of the other responses since that means it is not being expressed. D. It is heavily methylated.
Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you
Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a transcription factor. You have identified a novel variant in WT1: Arg422Pro. You have control cells and cells that have been engineered to carry the homozygous WT1 p.Arg422Pro mutation. You want to assess effects of this mutation on a variety of endpoints. For each endpoint listed below, choose the one technique is best suited to answer the question. Choose from: array CGH, qRT-PCR, qPCR, RNA-seq, FISH, in situ hybridization, western blot, immunostaining, WT1 ChIP-seq, WT1 ChIP-PCR, ATAC-seq, 3C Endpoint Technique? WT1 protein amount (quantitative) Western blot WT1 protein binding to all enhancers, genome-wide Chip-seq WT1 mRNA amount (quantitative) WT1 protein subcellular localization Quantitative assessment of all mRNAs in these cells (genome-wide) RNAseq Chromatin interactions between a specific WT1 chromatin binding site (identified above)…
Please answer fast Choose the correct answer: 1. Increased expression of RNA methyltransferase BCDIN3D will result in (1) Increased expression of miR-21 (2) Increased expression of miR-145 (3) Decreased expression of miR-145 (4) Decreased expression of miR-21 2. Which of the following statement is correct from (1), (2), (3) or (4)? (A) MiRNAs in the same cluster regulate overlapping set of genes (B) MiRNAs in the same cluster tend to be co-expressed (C) MiRNAs in the same cluster are always driven by different promoters (D) MiRNA in the same cluster may be stabilized by natural selection Chosee the correct answer: (1) A and C (2) A and D (3) A, B and D (4) A and B
can you please help me out with this ? Mutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency disorder (SCID) cases in humans. These mutations result in alterations to a protein component of cytokine receptors that are essential for proper development of the immune system. The IL2RG gene is composed of eight exons and contains upstream and downstream sequences that are necessary for proper transcription and translation. Below are some of the mutations observed. For each, explain its likely influence on the IL2RG gene product (assume its length to be 375 amino acids). Nonsense mutation in a coding region Insertion in Exon 1, causing frameshift Insertion in Exon 7, causing frameshift Missense mutation Deletion in Exon 2, causing frameshift Deletion in Exon 2, in frame (g) Large deletion covering Exons 2 and 3
What are the functional consequences of this deletion for lilP mRNA transcription and translation? Motivate your answer (100 words max.)
Antibiotic-resistance is one of the gravest dangers to the world’s medical system. As a result, Dr. Jhon Peῆa decides to apply for a research grant from the NIH to investigate novel targets for antibiotic treatment in his lab. Most bacteria have developed resistance to counter the effects of the current crop of antibiotics, which largely target the cell wall, plasma membrane, or ribosomes. Dr. Peῆa’s team has instead been investigating bacterial transcriptional sites and all of his students are asked to attend a group Zoom meeting to discuss ideas to put into the grant. 1) Dr. Wilhem, his post-doc, mentions that heat-sensitive RNA pol mutants found in yeast might be worth exploring to see if they could be genetically engineered into E. coli. He reckons that anyone who is sick from a bacterial infection typically develops a fever so this would activate their destruction. a GREAT IDEA! b SUCKY IDEA! Yeast are eukaryotic so their RNA pol binds to a different site…

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS