Answered: What direction does DNA polymerase…

Science

Biology

What direction does DNA polymerase extend and proofread DNA?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 4TYK: After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify...

See similar textbooks

Related questions

Q: 5) PCR primers have a melting temperature (Tm) at which they become dissociated from the template…

A: A primer is a short strand of nucleotide molecules that serves as an initial point for the synthesis…

Q: polymerase with 5'-3' as well as 3'-5' exonuclease and proofreading activity is Select one: a.…

A: The error-correcting processes used in the genetics is known as the proof reading. During the…

Q: In the dideoxy-sequencing reaction, what terminates DNA synthesis at a particular base? a. The…

A: The methods that are used for genomic sequencing are Sanger’s sequencing, chain termination…

Q: 5. Describe the process of DNA sequence of interest detection, using these terms appropriately,…

A: Introduction: DNA sequencing method is used to determine the exact base sequence in a DNA. Three…

Q: How can you modify your DNA model to reflect changes among DNA molecules?

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: 2. a. Research DNA quantitation by UV absorption. Explain what A230, A260 and A280 values represent.…

A: Every biomolecule have an unique absorbance curve of their own. This simply means that, the…

Q: DNA synthesis has a very low error rate. One reason for this is that the DNA polymerase enzyme can…

A: DNA polymerase is the enzyme that does maximum of the work throughout DNA replication. It builds a…

Q: Which of the following actions in the DNA extraction of strawberry separates the DNA from the rest…

A: You have asked mutiple questions. I will answer the 1st question, as allowed by guidelines. Asked…

Q: Which of the following alternative steps cannot be employed in the DNA extraction because it would…

A: You have asked multiple questions. I will answer 1st question, as allowed by guidelines. Asked :…

Q: 6. Describe the process of DNA sequence of interest detection, using these term appropriately,…

A: *DNA sequencing is a technique used to find the exact sequence of bases like Adenine, Guanine…

Q: The proofreading function of DNA polymerase involves the recognitionof a ________ and the removal of…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: Which statement on the migration of DNA fragments through agarose gels is false A) Small fragments…

A: Agarose gel electrophoresis is one the technique used in Recombinant DNA Technology and Molecular…

Q: 18. An instructor had her students perform this laboratory beginning with setting up their own…

A: Agarose gel electrophoresis is the technique for the separation of DNA fragments on the basis of…

Q: 1 What pairs with A? 2. What pairs with C? 3. DNA is semi-conservative. Why is this an efficient and…

A: The DNA (deoxyribonucleic acid) is the hereditary material of an organism. The DNA is a part of the…

Q: What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: The…

Q: 35) A researcher inserted DNA fragments from an organism into expression vector plasmids and…

A: A plasmid is a small, circular, extra double stranded molecule of DNA that is being different from…

Q: What characteristics of VNTR and STR make them useful for DNA fingerprinting?

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: 1) DNA polymerase can only add nucleotides to an available 3' end. Why? a. The enzyme is attracted…

A: DNA polymerase is a protein complex, which helps to synthesize a new strand of DNA from the template…

Q: 3. Give a schematic diagram of the different steps involved in PCR (Polymerised chain reaction) of a…

Q: One common feature of all DNA polymerases is that they a. synthesize DNA in the 3′-to-5′…

A: One common feature of all DNA polymerases is that they synthesize DNA in the 5'-3' direction.

Q: Why are mutations more likely to occur in repeated DNA sequences? a. These bases are unstable b.…

A: Repetitive DNA sequence Repetitive DNA refers to the stretches of DNA that repeat throughout the…

Q: You have a DNA sequence of 1400 bp. To characterize it, you decide to make a restriction map.…

A: DNA is a nucleotide polymer present in living beings.

Q: What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b.…

A: DNA molecule is a negatively charged molecule which is made up of nucleotides. Each nucleotide is…

Q: 3. A long DNA will be divided into small fragments, and one of them will be attached to the bead and…

A: Ion torrent sequencing is the method of sequencing by signals of pH change voltage generation, which…

Q: Considering the Polymerase Chain Reaction (PCR), we can state that: a) It is a technique that…

A: Introduction: Polymerase chain reaction is a method which is used to amplify a small amount of DNA…

Q: 9. Using your knowledge of DNA repair pathways, choose the pathway that would be used to repair the…

A: DNA repair pathways are a set of processes by which cell defines and corrects the damage to DNA that…

Q: What is the purpose of cell dissolution? 2. What is the purpose of DNA separation? 3. What is the…

A: Cell lysis : The method in which the cell membrane is broken down to release the inter-cellular…

Q: Which of the following statements is FALSE regarding the molecular mechanism for DNA polymerases?…

A: A DNA polymerase is the member of family of enzymes that catalyze the synthesis of DNA molecules…

Q: 1. The polymerase chain reaction (PCR) is used by scientists to amplify DNA, particularly when the…

A: We are answering 1st question only. For the rest of the questions please repost. The polymerase…

Q: explain why it is far less important for Primase to have proofreading activity than it is for DNA…

A: DNA proofreading is error correction process, in which DNA polymerase checks the each nucleotide…

Q: The proofreading function of DNA polymerase involves therecognition of a ________ and the removal of…

A: The process proof reading involves the removal of a newly added incorrect nucleotide. DNA polymerase…

Q: 1. What happens in the denaturing step of PCR? A. What happens during the annealing step of…

A: PCR is used widely in the fields of cell Biology, Forensic Researches, medical diagnostics, and in…

Q: The authors investigate if the switch from the polymerase to the exonuclease site involves releasing…

A: During DNA replication, accuracy is determined by rate of nucleotide incorporation by DNA…

Q: i the polymerase chain reaction, the DNA denaturation step requires a emperature in the range of ?°…

A: SOL1 In humans, fertilization is the fusion of a human egg or female gamete and sperm or male gamete…

Q: 6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence…

A: Sanger sequencing method is also known as chain termination method. It requires - DNA polymerase…

Q: 1. Upon the banana DNA extraction, what do you see in the top portion of the liquid when you look at…

A: DNA (Deoxyribonucleic Acid) is the genetic material of all living organisms whether plant, animal,…

Q: 4. A linear fragment of DNA is exposed to a digest containing the individual restriction enzymes…

A: For doing restriction mapping we need to arrange each fragments at it's proper position. The process…

Q: Rosalind Franklin (Early 1950s) A. What did she discover about the probable shape of DNA? B. What…

A: The experimental science that determines crystal atomic and molecular structure. This crystalline…

Q: What is the purpose of adding of (a) warm salt water, (b) detergent, and (c) alcohol on the…

A: Extraction of DNA from a banana involves mashing, filtration, precipitation and extraction.

Q: 1. The following gel was produced in manual DNA sequencing. What would the unknown DNA template be…

A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…

Q: 7. You are preparing a library to sequence two samples, one from a WS and one from a FS, via…

A: Introduction An aligned read is that sequence which has been aligned to a common reference genome.…

Q: Okazaki fragments are ________. A. short RNA primers needed for initiation of polymerization…

A: Okazaki fragments are the short and newly synthsizes DNA sequnces. They are important for DNA…

Q: 94. Which of the following is TRUE of DNA polymerases of eukaryotic cells? a. The same DNA…

A: DNA polymerase is typically used in the DNA replication process. Beta DNA polymerase is a subtype…

Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…

Q: DNA strands are anti-parallel and DNA polymerase can only synthesize DNA in a 5' to 3' direction.…

A: Replication is the process of making two identical DNA molecules from a double-stranded DNA…

Q: Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3' a. What is the…

A: According to the central DNA is converted to RNA (transcription) and RNA to protein (translation).…

Q: 1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP…

A: AP endonuclease : It is an enzyme which is involved in the DNA base excision pathway The main…

Q: 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

34. What direction does DNA polymerase extend and proofread DNA?

A. Extend: 5'--3' and 3'--5'; Proofread: 3'--;5'

B. Extend: 5'--3'; Proofread: 3'--5'

C. Extend: 5'--3'; Proofread: 5'--3'

D. Extend: 5'--3' and 3'--5'; Proofread: 5'--3' and 3'--5'

E. Extend: 5'--3'; Proofread: 5'--3' and 3'--5'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

110.Which of the following best explains the leading daughter DNA strand? A.The gaps within the leading strand are sealed by DNA ligase. B.The leading strand is synthesized by the enzyme primase. C.It is polymerized continuously by DNA polymerase from 5' - 3' direction. D. It is polymerized discontinuously by DNA polymerase from 5' - 3' direction which leaves gaps known as Okazaki fragments.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
1. What is/are the purpose(s) of DNA extraction? 2. What is the function of each reagent used in the extraction of DNA from a banana? a. Saltwater b. Liquid dishwashing soap c. Cold isopropyl alcohol
(1) DNA polymerase can only add nucleotides to an available 3' end. Why? a. The enzyme is attracted to the negatively charged phosphate group. b. The phosphate group at the 5' end interferes physically and/or electrically with the elongation process. c. The lagging strand needs to be synthesized more slowly. d. Okazaki fragments are critical to the formation of identical copies of DNA. e. No one knows.
Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.
1. The enzyme that fills the gaps between the Okazaki fragments is ________. a.DNA polymerase b.Helicase c. Ligase d. Primase 2. After helicase unwinds the two DNA strands, ____________ bind to the single stranded DNA. This keeps the two single stranded DNA separated. a. Topoisomerase b. Single stranded binding proteins c. Ligae d. DNA polymerase 3. To synthesize a new strand of DNA, DNA polymerase requires: a. inorganic phosphate b.dNTPs (dATP, dCTP, dGTP, dTTP) c. a free 3' OH group d.ATP e. template DNA Please answer asap and type your answer and do not copy from anywhere please
The proofreading function of DNA polymerase involves therecognition of a ________ and the removal of a short segment of DNA in the __________ direction. a. missing base, 5′ to 3′ b. base pair mismatch, 5′ to 3′ c. missing base, 3′ to 5′ d. base pair mismatch, 3′ to 5′