6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddTTP were also added. Write out the sequence of 4 DNA fragments you expect to produce in your sequencing reaction. Include the 5' and 3' ends of each fragment in your answer. 3' AAGACTCGATCGATCGTTTCCTCA 5'

6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddTTP were also added. Write out the sequence of 4 DNA fragments you expect to produce in your sequencing reaction. Include the 5' and 3' ends of each fragment in your answer. 3' AAGACTCGATCGATCGTTTCCTCA 5'

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

1) What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit this property of DNA (Word count: 200) 2) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference
The 50ul of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the gel?
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
1. Which of the following actions in the DNA extraction of strawberry separates the DNA from the rest of the solution? a. Addition of cold isopropyl alcohol b. crushing the strawberry c. Addition of soapy salt solution d. Filtration of the crushed strawberries 2. What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b. It displaced a lot of proteins to free the DNA. c. It disrupts the phospholipid bilayer. d. It precipitates the DNA.
1. Which of the following are generated due to the twisting of dsDNA? a. Hydrophobic bonds b. Van der Waal forces c. Hydrogen bonds d. Grooves 2. Which of the following terms refers to the annealing of ssDNA to complementary RNA? a. Homologous combination b. Hybridization c. Denaturation d. Telomere lengthening 3. Which of the following completes this statement? The melting temperature of DNA is the temperature at which__________. a. DNA denatures b. DNA bonds are reinforced c. Solid DNA becomes liquid d. Liquid DNA coils
1. What happens in the denaturing step of PCR? A. What happens during the annealing step of PCR? B. What happens during the extension step of PCR? C. What temperatures is associated with each PCR step? D. Why is it necessary to have a primer on each side of the DNA segment to be amplified? (Hint: draw it out to see what happens with only one primer). E. How did the Taq DNA polymerase acquire its name? F. Why are there nucleotides (A, T, G, C) in the master mix? What are the other components of the master mix and what are their functions?
1. The enzyme that fills the gaps between the Okazaki fragments is ________. a.DNA polymerase b.Helicase c. Ligase d. Primase 2. After helicase unwinds the two DNA strands, ____________ bind to the single stranded DNA. This keeps the two single stranded DNA separated. a. Topoisomerase b. Single stranded binding proteins c. Ligae d. DNA polymerase 3. To synthesize a new strand of DNA, DNA polymerase requires: a. inorganic phosphate b.dNTPs (dATP, dCTP, dGTP, dTTP) c. a free 3' OH group d.ATP e. template DNA Please answer asap and type your answer and do not copy from anywhere please
1. Upon the banana DNA extraction, what do you see in the top portion of the liquid when you look at your container? 2. Is the DNA you extracted pure? What are the possible impurities? 3. What can we do with the DNA once we have purified it? Discuss different techniques and technologies associated with this.
1. What is/are the purpose(s) of DNA extraction? 2. What is the function of each reagent used in the extraction of DNA from a banana? a. Saltwater b. Liquid dishwashing soap c. Cold isopropyl alcohol
Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this sequenceand then write the sequence of the complementarystrand below it.GTTCGCGGCCGCGAACComparing the top and bottom strands, what do younotice about the relationship between them?
5’ ATGCTAGACGTGTTCTAG 3’3’ TACGATCTGCACAAGATC 5’Moving from left to right, the bottom DNA strand will be read continuously.a. Tb. F
. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′