What is an example of RNA editing? Changing a valine codon to a stop codon Methylation of cytosine bases Formation of RISC Alternative splicing
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…
Q: An experiment is performed to test a suggested mechanism for an enzyme-catalyzed reaction. The…
A: INTRODUCTION : Enzyme : Enzymes are proteins which act as biochemical catalysts by accelerating or…
Q: Will disaccharides and polysaccharides give positive results in Molisch test? How?
A: Molisch’s test is a specific test for the identification of carbohydrates in a sample. The test uses…
Q: Write the schematic diagram of lodine Value Determination as shown in the video by Amrita Vlab:
A: Simple fats are triglycerides. Triglycerides or triacylglycerols are fatty acid esters of glycerol.…
Q: Which of the following enzymes is NOT used when fructose is metabolized to pyruvate in the liver? a.…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: Calculate the number of ATP molecules obtained from the anaerobic conversion of each of the…
A: Anaerobic metabolism is the process in which ATP is produced without oxygen, i.e. ATP is formed by…
Q: Process: State (at right)
A: The cell membrane is composed of a phospholipid bilayer. The proteins embedded in the membrane (…
Q: Would you expect the structure of a competitive inhibitor of a given enzyme to be similar to that of…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: In the article the authors reference the canonical forces in protein folding. Describe how these…
A: As per the central dogma of molecular biology, the DNA contain the information needed to synthesize…
Q: What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B? O…
A: Apolipoprotein B is encoded in humans by APOB gene. It is the primary apolipoprotein of VLDL, LDL…
Q: What is the experimental procedure illustrated in the figure above? What label (1-3 words) would…
A: In the given diagram, some cutting and joining of DNA is shown. In the diagram, a specific gene…
Q: DNA: Explain the Meselson-Stahl Experiment.
A: The mode of replication in DNA, in which a parental duplex DNA gives rise to two identical daughter…
Q: The degradation of nutrients for energy is also known as oxidative metabolism. True False
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: Formation of a GC-rich stem-loop in the mRNA is required for function of an intrinsic transcription…
A: Transcription is the process in which mRNA corresponding to a gene is synthesized by RNA Polymerase.…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone that regulates blood glucose in levels in the body. It decreases the…
Q: In a hydrogen fuel cell, hydrogen gas and oxygen gas are combined to form water. Write the balanced…
A: Water molecule is a compound formed from hydrogen and oxygen gas. It has two Hydrogen atoms and one…
Q: Make use of the table below in answering the questions asked: Amino acid pK₁ PK₂ pK3 2.32 9.76 2.32…
A: Isoelectric point is the ph at which the peptide carries a net charge of 0. The proteins are least…
Q: Which of the following are true about oxaloacetate? It can cross mitochondrial membranes It is an…
A: Glycolysis is a pathway which breaks down glucose into two three-carbon compounds and produces…
Q: Name 2 prominent secondary structure of protein，lable out 3 differences between them.
A: Proteins are the polymers of amino acids. They have four different levels of structural…
Q: 5. (a) Hexokinase IV is known as glucokinase (GCK) and is a central metabolic enzyme that…
A: Hexokinases: An enzyme that phosphorylates hexoses (six-carbon sugars) to produce hexose phosphate.…
Q: Hair is comprised largely of keratin, a fibrous protein consisting of two a-helices wrapped around…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Thick filaments are part of the I band contain actin O contain myosin but thin filaments do/are not.…
A: In each microfibril, actin thin filaments and myosin thick filaments are organized into a linear…
Q: Which one of the following statements about PEP (phosphoenolpyruvate) synthesis is correct? Pyruvate…
A: PEP, also known as 2-phosphoenolpyruvate, is a crucial biochemical intermediary. It participates in…
Q: Which is the strongest non-covalent interaction that occurs between triglycerides: hydrogen bonds,…
A: - A non-covalent bond is one in which there is no sharing of electron pairs. It mainly occurs…
Q: What is the goal of glycolysis? What do we start with and what do we end with? How much net ATP is…
A:
Q: A biosynthetic pathway for the synthesis of two molecules, E or H, from molecule A is shown below.…
A: Enzymes can e reversibly inhibited in presence of competitive and non-competitive inhibitors. Such…
Q: To get all of the amino acids out of the oligopeptide below and into the bloodstream through the…
A: Oligopeptide: Any of the enzymes in the family of proteolytic enzymes, commonly known as proteases,…
Q: reaction of glyceraldehyde-3-phosphate to form dihydroxyacetone phosphate
A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…
Q: Kwon Soon-young was asked by his CHEM 160.1 lab instructor to determine the isoelectric pH of an…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: In biochemistry, what is definition of buffer , which amino acid can act as buffer? what is buffer…
A: The functioning of many molecules such as proteins, nucleic acids etc. depends on pH. The pH in…
Q: The following peptides were separated using ion-exchange chromatography based on the use of an anion…
A: Ion exchange chromatography separates fractions based on net charge. There are two types of ion…
Q: 1. What color change do you observe in Part B of the experiment? In which of the test tubes did…
A: Proteins are made up of amino acid residues linked via a peptide bond. A peptide bond between two…
Q: The ΔG°' for hydrolysis of ATP to ADP + Pi is -30.5 kJ/mol. -Calculate the equilibrium constant for…
A: Standard Gibbs free energy change (∆G0') is the change in Gibbs free energy at standard conditions.
Q: Which pathways use substrate-level phosphorylation and which use oxidative phosphorylation?
A: Substrate-level phosphorylation is a metabolic process that involves the direct transfer of a…
Q: What is most correct about the following inhibition? Penicillin
A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…
Q: Discuss the role (direct or indirect) of carbohydrates on cancer and Suggest an appropriate…
A: Carbohydrates, lipids, and proteins are the biomolecules that are required in large amounts by the…
Q: The mitochondrial matrix is home for the following: I. ribosomes II. circular DNA III. Kreb's…
A: Mitochondria is a membrane bound organelle which is also known as power house of the cell as it is…
Q: Consider the given data for an enzyme-catalyzed reaction. Determine the Vm, Km and the type of…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Given the following reaction below, what amino acid is involved and what is the specific reaction…
A: Phenylalanine, tyrosine, and tryptophan are aromatic amino acids. The side chain of the…
Q: Problem 1: Calculate the hydrolysis of ATP at pH 7 at 37°C under steady state conditions in which…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: fructose-6-phosphate + ATP fructose-1,6- biphosphate + ADP AG = 30.5 and 16.3 respectively Standard…
A: The Gibbs free energy (G): It is the thermodynamic function that best captures the energetics of…
Q: d) Cleavage by trypsin followed by gel-filtration chromatography gives the expected 6 products,…
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: In an Absorptive (fed) state Which predominates? Anabolic or catabolic processes? Which ones…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Events that occur in the peroxisomes incluce the following EXCEPT oxidation of fatty acids…
A: Peroxisomes are small, membrane-bound organelles in eukaryotic cells that contain enzymes involved…
Q: Given 2 M Tris, pH 7.1 (pKa 8.0), 5 M NaOH, 5 M HCI, and water; how would you prepare 2 L of 0.2 M…
A: Equation of dilution: M1V1 = M2V2 where: M1 is the molar concentration of the stock solution. M2 is…
Q: Yeast cells are grown with galactose as the sole carbon source and ATP levels are abundant. Describe…
A: GAL genes: The GAL genes, which include structural (GAL1, GAL10, GAL2, and GAL7) and regulatory…
Q: Create your OWN diagram to show the lock-and-key theory of enzyme activity.
A: There are two theories describing enzyme activity. They are: 1) Lock and Key Theory and 2) Induced…
Q: Which protein structural features are apparent in the protein structure below? Select all that apply…
A: Different bonds contribute to protein folding. These bonds are hydrogen bonds, hydrophobic bonds,…
Q: Canonical forces in protein folding. Describe how these forces come into play when a protein folds.
A: INTRODUCTION : Canonical forces in protein folding - Canonical forces are those forces which…
Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…
A: Note: As per the honor code we are allowed to answer the first two questions. Kindly resubmit the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Target of doublestranded rna during RNAi is determined by...... size molecular weight sequence fragmentationIf there are multiple start condo, how can you identify the real start codon? By observing Okazaki fragments By identifying splicing site Using sequence data bases By identifying Kozak sequence Which one is not a part of the transcription unit? RNA primase Promoter RNA coding sequence TerminatorWhat is RNA editing? Explain the role of guide RNAs in RNA editing.
- For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.GCT GAC ATC CTC CTC mutated DNA sequence mutated mRNA sequence mutated amino acid sequence Above is the mutated DNA sequence for part of the 21 hydroxykase gene. Provide the mutated mRNA and amino acid sequence.The type of RNA modification that requires guide RNAs is ________. removal of introns RNA editing splicing together of exons addition of the 3 polyadenylated tail addition of the 7-methylguanosine cap to the 5 end
- A particular DNA coding segment is ACGTTAGCCCCAGCT • Write the sequence of nucleotides in the corresponding mRNA. • Determine the amino acid sequence formed from the mRNA during translation. • What amino acid sequence results from each of the following mutations? a. replacement of the underlined guanine by adenine b. insertion of thymine immediately after the underlined guanine c. deletion of the underlined guaninewhat to do when you have a stop codon while designing SGRNA for Crispr? I have design SGRNA but it sit within the CDS region of my target site and that region have a stop codon (TGA)The following segment of mRNA encodes an interstitial segment of a polypeptide (thedifferent codons appear separately): 5'... AAU CUA UUC AUU AAA ACC ... 3'a) Determine the sequence of the two strands of the DNA fragment from which this RNA comes. highlighting the sense and antisense strandb) What will be the corresponding amino acid sequence that originates in the translation
- Of all of the different codons that exist, three of them ___. do not specifiy a particular amino acid and are signals to terminate translation do not specifiy a particular amino acid and are signals to begin translation are involved in mutations cannot be copied give the signal to stop translationWhich pre-mRNA processing step is important for initiating translation? a. poly-A tail b. RNA editing c. splicing d. 7-methylguanosine capThis type of mutation, where one nucleotide was replaced for another, is called a point mutation. White skin and blue eyes are examples of point mutations.Provide the mRNA that will be made from the mutated strand : 3' TAATATATCCGTACCGTTTAAAGGGTTACATAATTTTTCATCCCATTA5'