What is the output of the following C code: Code: #include #include void hack_fun (char p[]){ p= "alice, Bob"; } int main() { char x[] = "Alice, bob"; hack_fun(x); printf("%s", x); return 0;

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…

Create a flowchart for this program in c++, #include <iostream>#include <vector> // for vectors#include <algorithm>#include <cmath> // math for function like pow ,sin, log#include <numeric>using std::vector;using namespace std;int main(){    vector <float> x, y;//vector x for x and y for y    float x_tmp = -2.5; // initial value of x    float my_function(float x);    while (x_tmp <= 2.5) // the last value of x    {        x.push_back(x_tmp);        y.push_back(my_function(x_tmp)); // calculate function's value for given x        x_tmp += 1;// add step     }    cout << "my name's khaled , my variant is 21 ," << " my function is y = 0.05 * x^3 + 6sin(3x) + 4 " << endl;    cout << "x\t";    for (auto x_tmp1 : x)        cout << '\t' << x_tmp1;//printing x values with tops    cout << endl;    cout << "y\t";    for (auto y_tmp1 : y)        cout << '\t' << y_tmp1;//printing y values with tops…

Please complete the following guidelines and hints. Using C language. Please use this template: #include <stdio.h>#define MAX 100struct cg { // structure to hold x and y coordinates and massfloat x, y, mass;}masses[MAX];int readin(void){/* Write this function to read in the datainto the array massesnote that this function should return the number ofmasses read in from the file */}void computecg(int n_masses){/* Write this function to compute the C of Gand print the result */}int main(void){int number;if((number = readin()) > 0)computecg(number);return 0;}Testing your workTypical Input from keyboard:40 0 10 1 11 0 11 1 1Typical Output to screen:CoG coordinates are: x = 0.50 y = 0.50