What is the point of DNA replication? ____________________________ When & where does replication occur? _____________________________ What is the point of transcription? _______________________________ Where does it occur? _____________________________

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: . Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: The central dogma of molecular biology describes the flow of genetic information in the cell from…

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA   1. In…

A: The first step in gene expression is the synthesis of an RNA molecule copied from the segment of DNA…

Q: Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino…

A: Transcription is the process in which m RNA is synthesized and the translation is the process in…

Q: Compare the process of Replication, Transcription, and Translation by describing the following…

A: In the molecular biology, the genetic information is encoded in the DNA. Central dogma consists of…

Q: Given the following enzymes, fill up the table. You may repeat answers in each column. Replication…

A: Central dogma Central dogma involves the process that encodes the functions of a gene leading to…

Q: Which of the DNA polymerases shown in Table  have the ability to proofread?

A: The DNA polymerase enzyme uses a single stranded DNA molecule as a template and causes the synthesis…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…

A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…

Q: The schematic diagram below shows the functional organization of transcribing RNA polymerase. Match…

A: Transcription is the next step after replication in the central dogma of biology. It is the process…

Q: Which primer would be appropriate to amplify the top strand of the DNA molecule shown? 5'…

A: Polymerase chain reaction is a method widely being used to make multiple copies of the same DNA…

Q: REPLICATION TRANSCRIPTION TRANSLATION Molecule or enzyme a) DNA Polymerase a) Ribosomes b) RNA…

A: Replication- DNA replication requires other enzymes in addition to DNA polymerase, including DNA…

Q: DNA strand below: 3’ T A C A T G C C G A A T G C C 5’  Discuss how will replication happen by…

A: The central dogma of molecular biology involves replication, transcription and translation.…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: The DNA is composed of purines and pyrimidines. The purines in DNA are adenine and guanine. The…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: DNA ligase

A: The correct option is Option 3. DNA ligase

Q: Please explain the full DNA synthesis process

A: DNA synthesis occurs when a cell divides,  in the process known as replication. DNA replication is…

Q: Identify the solution component that contains the extracted DNA.

A: Ethanol precipitation method is generally used for DNA extraction.

Q: The sequence below shows a mRNA sequence derived from a template strand of a DNA molecule: DNA…

A: DNA undergoes replication to form 2 DNA molecules (one parental strand and one new strand) and then…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…

Q: CRITERIA REPLICATION TRANSCRIPTION TRANSLATION Template used Direction of synthesis Protein/enzyme…

A: Template used  DNA Direction   5'-3' direction Protein/enzyme for initiation   Helicase,primase,…

Q: Shown here is a DNA sequence. Which strand is the template?…

A: There are two types of strands in transcription process of the eukaryotic DNA  Template strand…

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Describe the synthesis of the leading strand during DNA replication. Assume the replication bubble…

A:

Q: The sequence below shows the ends of one strand of a linear chromosome, with slashes representing…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided…

A: DNA is a double helical structure that comprises of tel strand running in opposite directions. Both…

Q: Why do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?

A: DNA chip used in microarray

Q: Match the following functions to each of the enzymes listed below. Some Functions of Enzymes Build…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Which of the following processes of genetic information flow can occur under laboratory conditions,…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…

Q: Assume that you are a RNA polymerase. Which strand is the template strand?…

A: Second one is the template strand for RNA polymerase.

Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…

A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…

Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…

A: The hydrolysis is targetting the 3' Carbon of the sugar in the phosphodiester bond. 1st strand…

Q: Identify the dinucleotide CA repeat region and the score in the following sequence:…

A: Nucleotide is defined as the basic block of DNA and RNA that also known as building block of it.

Q: Sort the phrases into the appropriate bins depending on which protein they describe. 1) Binds at the…

A: Deoxyribonucleic acid (DNA) replication process involves copying DNA from the existing DNA. In DNA…

Q: ’. Envision that each is a section of a DNA molecule that has separated in preparation for…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: Please draw or send me a picture of the structure of DNA and label the parts. Thank you very much.

A: Deoxyribonucleic acid: DNA is a genetic material that is present within the nucleus. It was…

Q: Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Complementary DNA sequence: mRNA…

A: DNA molecule is the genetic material present in the animals. Genetic material  is present in the…

Q: Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA,…

A: DNA is the genetic material of almost all living organisms. The DNA is inherited from the parents…

Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC

A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…

Q: Use the following information to answer the next four questions. Nucleic Acid…

A: Nucleic acids are the polymers of the nucleotides.

Q: DNA strand below: 3’ T A C A T G C C G A A T G C C 5’  Discuss how will replication happen by…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Compare the process of Replication, Transcription, and Translation by describing the following…

A: DNA is genetic material in most of the organism . It carries genetic information which is required…

Q: Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will…

A: BamHI is a type II restriction endonuclease that can recognize short DNA sequences (6 bp) and cleave…

Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Write the sequence of nucleotides in the blanks below and include 5' to 3' labels to show the…

A: DNA or deoxyribonucleotide is a nucleic acid responsible for carrying genetic information in most of…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: DNA is made out of four unique sorts of nucleotides, in particular, adenine, thymine, cytosine, and…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Given Sequence:

A: The genetic information stored in a cell is transcribed into a messenger RNA by the process of…