What is wrong with this code and how do I fix it? “void Increment(int); int main() {   int count = 1;   while(count < 10)   cout << " The number after " << count; /* Function Increment   Increment(count); adds 1 to count */   cout << " is " << count << endl;   return 0; } void Increment (int nextNumber) // Increment the parameter by 1. {   nextNumber++; }”

In C programming: Write a function printAllCourses() which receives an array of course pointers and the array’s size, then prints all courses in the array by calling printCourseRow()

C programming: Use following code and modify in the end to get median. Sorting is not needed as it already sorted. #include <stdio.h> #define MAX_SCORE 20#define MAX_SIZE 1000 int main() {int i = 0 ; // used as index into arrayint n = 0 ; // number of items in arrayint r ; // used to ensure user enters an integerdouble average ; // average of numbers entered by userdouble num ; // total number of items in array int A[MAX_SIZE] ; // will hold the scores n = 0 ;i = 0 ; // read in the scores into array A[]while (1) {r = scanf("%d", &A[i] ) ; // end of input?if ( r <= 0 ) {break ;} i = i + 1 ;// exceeded array size?if (i >= MAX_SIZE) {break ;}} // Make n the number of items stored in A[]n = i ; // compute the average int sum = 0 ; for (i = 0 ; i < n ; i++) {sum = sum + A[i] ;} num = n ; // num is doubleaverage = sum / num ; printf ("The average score is: %f\n", average) ; // *****// ***** TODO// *****// Declare a new count[] array.int count[MAX_SCORE + 1] ; // Initialize…

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…