Which of the introns listed below are usually removed from hnRNA only by spliceosomes? non-transcribed spacers Type II introns viroids Type I introns hammerhead ribozymes

Q: 7) Describe in detail the mechanism by which the major spliceosome removes introns from pre-mRNA…

A: Spliceosome is a complex small nuclear RNA protein molecule also called snRNA that helps to remove…

Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)

A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…

Q: 2' HO 5' OH-3' -OH-3 |3' M O A represents Group I introns and B represents spliceosome introns O A…

A: Here,the answer is A represents Group II introns and B represents Group I introns. Group I and Group…

Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Which of these molecules is responsible for bringing the correct amino acid to the ribosome? acetyl…

A: Translation is the process by which the cells of the body prepare their own proteins in the…

Q: Explain why do eukaryotic mRNAs have to be “processed” whereas most prokaryotic RNAs do not?

A: Ribosomal and transfer RNAs are processed in both prokaryotes and eukaryotes. The processing of…

Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…

A: Only proline amino acid form as second codon is stop codon here

Q: 1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: 8. Which of the following best describes the messenger RNA (MRNA) molecules found in prokaryotes? A.…

A: Disclaimer : Since you have asked multiple question, we will solve the first question for you. If…

Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…

Q: 1. What are the amino acids translated from the resulting mRNA?

A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

Q: Why aren't ssb proteins necessary in transcription?

A: The function of SSB protein is to prevent the recoiling of parent strands during replication. As we…

Q: 1. During RNA splicing, the of the precursor mRNA are being removed. Exons Introns Promoters…

A: RNA splicing is a process by which non coding sequences of RNA are removed. The coding sequences…

Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…

A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…

Q: 2. For each of the following types of gene regulation, indicate whether it occurs in eukaryotes…

A: Gene regulation is the term used to describe any mechanism used by a cell to increase or decrease…

Q: 2. What would happen if a mutation in DNA changed codon 6 in the MRNA to GUA? (This one nucleotide…

A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…

Q: Given the DNA sequence 5′-AUG GCU AGA GUU GAA  AAA-3′, which of these sequences represents a silent…

A: According to bartleby expert guideline we are allowed to answer only one question. Kindly repost the…

Q: 1)Which of these molecules is responsible for bringing the correct amino acid to the ribosome? RNA…

A: Translation is the process by which proteins are synthesized using ribosomes. It takes place in the…

Q: 2. The yeast gene encoding a protein found in themitotic spindle was cloned by a laboratory…

A: A protein is encoded by the yeast gene that is found in the mitotic spindle. This gene is cloned by…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: 3)Which of the following are involved in translation? Choose all that apply ribosome tRNA amino…

A: Answer-  Involved in translation are  :- ribosome tRNA  mRNA rRNA amino acids

Q: 10. Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present…

A: Disclaimer : Since you have posted a question with multiple subparts, we will solve first three sub…

Q: 2. There is no sigma factor on the RNA polymerase II. How does RNA polymerase Il know where to start…

A: Usually in Eukaryotic transcription initiation the transcription factor identifies promoter and then…

Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…

A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…

Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…

A: In this question we have to describe about regulation of genes . See full answer in step 2.

Q: 4)Which of the following have codons? Choose all that apply DNA RNA polymerase proteins tRNA…

A: Codons are the set of three nucleotides which encode a particular amino acid.

Q: Which of the following is a true statement concerning condons

A: Codons are nucleotide triplets that are read together in order to specify amino acids during…

Q: . What are the functions of the following list of RNAs; a. mRNA b. rRNA c. snoRNA d. snRNA e. tRNA…

A: RNA is a single strand of ribonucleic acid which is made up of polynucleotide chain. A nucleotide…

Q: Discuss how cholesterol is transported between tissues in plasma lipoproteins.

A: Plasma lipoproteins (LPs) are soluble aggregates of lipids and proteins which deliver hydrophobic,…

Q: 12) Which of the following processes occurs during transcription? A) DNA is replicated B) RNA is…

A: The information for the production of functional proteins are stored in segments of DNA called…

Q: What are the components of the initiation complex for translation

A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…

Q: 1.  Two closely related species may have a very similar genome size but very different number of…

A:

Q: 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…

A: 1. The messenger RNA (mRNA) is produced by the process of transcription from a double-stranded DNA…

Q: . Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous…

A: 1.Answer-- correct option is (b)        Nucleotide excision repair

Q: Which of the following introns are usually removed from hnRNA only by spliceosomes? non-transcribed…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…

A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…

Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…

A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…

Q: 2. Which one of the following statements is TRUE of bacterial transcription? A. It produces pre-mRNA…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 3. What is meant by the term histone code? With regard to gene regulation, what is the proposed role…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 8. The CAS9 enzyme (shown in red in the image below arget and cut out specific DNA sequences.

A: As you have not mentioned which part to answer, we are answering first three for you. If you want…

Q: 3.explain why the following statement is false. "Interaction of specific transcription factors and…

A: Note: Since you have posted multiple independent questions in the same request, we will solve the…

Q: 2. How is RNA termination different in prokaryotes vs eukaryotes? Include an explanation of cis vs.…

A: The process of creating a copy of RNA (ribonucleic acid) of a gene sequence can be referred to as…

Q: Which of the following introns are usually removed from hnRNA only by spliceosomes? A.…

A: hnRNA stands for heterogeneous nuclear RNA. It refers to the large pre‐mRNAs of various nucleotide…

Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…

A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…

Q: 2. Write the base sequence of the hnRNA formed by transcription of the following DNA base sequence.…

A: hnRNA is also called as the heteronuclear RNA. Its synthesis is catalyzed by RNA polymerase II.…

Q: 1. Which of the following enzymes can polymerize deoxyribonucleotides into DNA? A) Primase B) DNA…

A: There are different biomolecules present, and they include nucleic acids, proteins, lipids,…

Q: Why can introns be of any length?

A: Hey, since there are multiple questions posted, we will answer first question. If you want any…

Q: 12. The following codons and the amino acids they encode is as follows: AUG = Met %3D UUU, UUC = Phe…

A: ANSWER;- a) The sequence of amino acids in the following structure Met-Phe-Leu-Ser-Thr-Pro b)(i) DNA…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which functions as genetic material in most…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.