Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note: Ignore the colors)

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: Which of the following sequences is most likely to form a beta-turn? Explain why?…

A: The majority of proteins are globular in form. Thus, forming, turning, bending, or reorienting is…

Q: If a single strand of a gene contains 678 bases, how many amino acids result in the polypeptide…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of cell.

Q: Identify which mutagen is described by the following statement. Causes alkylation of guanine bases.…

A: Mutagens are the physical or chemical components which causes a permanent change in the genetic…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…

A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG  mRNA codon is ..…

Q: What does “Universality and Degeneracy” of the Genetic Code mean? State the significance of both the…

A: The genetic code is said to be nearly universal. It means that a given codon specifies the same…

Q: What are the codons for the variations amino acid?

A: Amino acids are organic compounds that combine to form proteins, which are the building blocks of…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:

A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…

Q: What would be the effect of an insertion or deletion of one of the bases in a codon?

A: Mutation may be defined as change in single or multiple base pairs resulting in altered phenotype.…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…

A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…

Q: Why is the term “proteome” ambiguous, whereas the term“genome” is not?

A: The proteins are the essential part of living organisms and it consists of thousands of smaller…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

A:

Q: The codon is found on mRNA? True or False?

A: Codon is a sequence of three consecutive nucleotides in DNA or RNA, that codes for a specific amino…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA  is converted into a…

Q: If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Give the ABBREVIATED NAME of the nucleotide in the 5' end." OCH

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…

A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…

Q: . What mRNA base sequence would be obtained from the following portion of a gene?

A: Genetic information is transferred from genes to the proteins via messenger RNA.…

Q: Approximately what portion of the human genome is composed of repeat sequences?

A: According to the results found in the human genome studies it is seen that the human genome has…

Q: Assuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides…

A: The process in which the messenger ribonucleic acid (mRNA) molecule sequence is translated to form…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…

A: The process of protein synthesis using the information in an organism's DNA is called central dogma…

Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: What codons are used and with what frequency?

A: mRNA is translated to form proteins. mRNAs contain trinucleotides sequences that are called codons.…

Q: The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino…

A: A genetic code is a triplet code of nucleotides that codes for a specific amino acid. It is also…

Q: How many introns are present on a gene that consists of 2 exons?

A: Introns and exons are nucleotide sequences in a gene. Introns can be considered as intervening…

Q: Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?…

A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…

Q: How can you identify the start codon in the mRNA sequence ?

A: mRNA sequence During the process of translation, mRNA is read on the basis of genetic code that…

Q: What could be the effect of a deletion, substitution or addition that alters the sequence of the…

A: Stop codon is a nucleotide triplet which is present in mRNA. This is also known as termination…

Q: What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read…

A:

Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…

Q: How many codons are there in the mutated DNA-(b) and DNA-(c)? What types of mutations occurred in…

A: Codon is sequences of three DNA or RNA nucleotides.

Q: Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G…

A: The above mentioned elongation factors are involved in the process of translation in prokaryotes.…

Q: What happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?

A: Gene is a stretch of DNA that codes for a particular polypeptide chain.

Q: Name the three non-sense codons?

A: The genetic material is known to carry the information that is translated and read as triplet code,…

Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Which CODON is the Start one?

A: 20.   Translation of mRNA always begins with the start codon AUG which codes for methionine.…

Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…

A: Introduction  Gene expression can only occur when the Gene is transcribed into mRNA and then this…

Q: Name the two initiating codons?

A: From the central dogma concept, we knew there is an intricate connection between genes and synthesis…

Q: Which of the following mutations in the protein-coding region of a gene is more likely to lead to…

A: A frameshift mutation is a type of gene mutation in which the insertion or deletion of one or more…

Q: What amino acid is coded by the original sequence (GTA) if the sequence refers to the template…

A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…

A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…

Q: If the gene undergoing protein synthesis consists of 24 bases, how many codons does that result in?…

A: In genetic code a unit known as codon, which codes for amino acid. For example the sequence AUG is a…

Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…

A: The proteins are the fundamental biomolecules in the body and act as substrates, enzymes, and…

Q: The human genome contains thousands of sequences known as small open reading frames, some of which…

A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…

Q: Put the following steps of transcription in order

A: The Central Dogma Theory is one of the most important concepts in the field of Cell Biology. It…