EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 28PDQ
One of the most common spontaneous lesions that occurs in DNA under physiological conditions is the hydrolysis of the amino group of cytosine, converting the cytosine to uracil. What would be the effect on DNA structure of a uracil group replacing cytosine?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?
In the following sequence, a cytosine was deaminated and is now a uracil (underlined).
5’-GGTAUTAAGC-3’
a. Which repair pathway(s) could restore this uracil to cytosine?
b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s).
c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b?
d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?
A spontaneous deamination of cytosine to uracil in DNA occurs at a rate about 100 bases per
cell per day. Explain the DNA repair mechanistic steps that can remove uracil and repair the
DNA break.
Chapter 10 Solutions
EBK CONCEPTS OF GENETICS
Ch. 10 - Would an experiment similar to that performed by...Ch. 10 - In sea urchin DNA, which is double stranded, 17.5...Ch. 10 - German measles results from an infection of the...Ch. 10 - What vital clues were provided by Franklins work...Ch. 10 - Was it ethical for Wilkins to show Franklins...Ch. 10 - Prob. 3CSCh. 10 - HOW DO WE KNOW? In this chapter, we first focused...Ch. 10 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 10 - Discuss the reasons proteins were generally...Ch. 10 - Contrast the contributions made to an...
Ch. 10 - When Avery and his colleagues had obtained what...Ch. 10 - Why were 32P and 35S chosen for use in the...Ch. 10 - Does the design of the HersheyChase experiment...Ch. 10 - What observations are consistent with the...Ch. 10 - What are the exceptions to the general rule that...Ch. 10 - Draw the chemical structure of the three...Ch. 10 - How are the carbon and nitrogen atoms of the...Ch. 10 - Adenine may also be named 6-amino purine. How...Ch. 10 - Draw the chemical structure of a dinucleotide...Ch. 10 - Describe the various characteristics of the...Ch. 10 - What evidence did Watson and Crick have at their...Ch. 10 - What might Watson and Crick have concluded had...Ch. 10 - How do covalent bonds differ from hydrogen bonds?...Ch. 10 - List three main differences between DNA and RNA.Ch. 10 - What are the three major types of RNA molecules?...Ch. 10 - How is the absorption of ultraviolet light by DNA...Ch. 10 - What is the physical state of DNA after it is...Ch. 10 - What is the hyperchromic effect? How is it...Ch. 10 - Why is Tm related to base composition?Ch. 10 - What is the chemical basis of molecular...Ch. 10 - What did the WatsonCrick model suggest about the...Ch. 10 - A genetics student was asked to draw the chemical...Ch. 10 - Considering the information in this chapter on B-...Ch. 10 - One of the most common spontaneous lesions that...Ch. 10 - In some organisms, cytosine is methylated at...Ch. 10 - Because of its rapid turnaround time, fluorescent...Ch. 10 - Prob. 31ESPCh. 10 - Newsdate: March 1, 2030. A unique creature has...Ch. 10 - During gel electrophoresis, DNA molecules can...Ch. 10 - DNA and RNA are chemically very similar but are...Ch. 10 - Electrophoresis is an extremely useful procedure...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 2) When DNA is placed in distilled water, which is pH 7.0, it denatures (i.e., the two strands separate). The pH inside a cell is generally 7.2-7.5, depending on the organism, but DNA is generally double-stranded under physiological conditions. Briefly explain, in your own words, why DNA denatures when placed in distilled water but not when it is inside a cell. [Reminder: the pKa for the phosphate groups in the sugar-phosphate backbone of a strand of DNA is 2.14]arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardSnake venom phosphodiesterase hydrolyzes nucleotides from the 3' end of any oligonucleotide and cleaves between the 3' hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. Which nucleotide would be released first from the oligonucleotide shown below upon treatment with snake venom phosphodiesterase? choices a. Deoxythymidine 5'-monophosphate b. Deoxyguanosine 3'-monophosphate c. Deoxyguanosine 5'-monophosphate d. Guanosine 5'-monophosphate e. Deoxythymidinearrow_forward
- Enediynes are natural products with potent antitumor properties because they are able to cleave DNA (page 288). Their cytotoxic properties are due tothe enediyne undergoing a cyclization to form a highly reactive diradical intermediate. The intermediate abstracts hydrogen atoms from the backbone of DNA, which triggers its damage. Draw the structure of the diradical intermediate.arrow_forwardConsider a three-base sequence in the template of DNA: 5' . . . 123 . . .3', in which 1, 2, and 3 refer to the relative positions of deoxyribonucleotides.Comment on the probable effect on the resulting protein if the following point mutations (one-base substitutions) occurred.(a) changing one purine for another in position 1(b) changing one pyrimidine for another in position 2(c) changing a purine to a pyrimidine in position 2(d) changing one purine for another in position 3arrow_forwardCystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forward
- In E. coli, all newly synthesized DNA appears to be fragmented (an observation that could be interpreted to mean that the leading strand as well as the lagging strand is synthesized discontinuously). However, in E. coli mutants that are defective in uracil–DNA glycosylase, only about half the newly synthesized DNA is fragmented. Explain.arrow_forwardBearing in mind the different number of hydrogen bonds that form between the two different purine- pyrimidine pairs in DNA, how would you explain the fact that DNA that is rich in cytosine-guanine pairs requires heating to a slightly higher temperature in order to separate the strands than DNA that is rich in adenine-thymine pairs?arrow_forwardDNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?arrow_forward
- Cytosine can be deaminated to form Uracil What type of mutation is this classified as? Discuss what happens to the base-pairing properties from switching from C to U? When U is replicated in two rounds of synthesis, what substitution does this result in? Before Uracil alters the DNA during replication, what repair system can be used to correct this error? Describe how this type of DNA repair works?arrow_forwardWhat is the methyl group-containing nucleobase composition of a double- stranded eukaryotic DNA with 52,000 bases that contains 22% bicyclic nucleobases characterized to have both an amino group and a keto group? (Instructions: Do NOT put spaces or commas or additional words/letters/units; Type in your answer in NUMERICAL FORM with the following format: 1234567)arrow_forwardWhat would the effect be if there was a substitution of one nucleotide for another?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license