SAPLINGPLUS F/BIOCHEM+ICLICKER REEF-CODE
9th Edition
ISBN: 9781319398583
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 10, Problem 7P
Interpretation Introduction
Interpretation:
The effect of a mutation in an allosteric enzyme that resulted in a
Concept introduction:
Enzymes being the catalysts increase the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
GTTTTCACTGGCGAGCGTCATCTTCCTACT
8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
plz explain with thorough explanation
AAAGAGAAAAGAAUA
to AAAGAGAAAUGAAUA.
Suppose the codon sequence
has a single base pair mutation
If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene?
(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.)
Submit Answer
Retry Entire Group No more group attempts remain
Chapter 10 Solutions
SAPLINGPLUS F/BIOCHEM+ICLICKER REEF-CODE
Ch. 10 - Prob. 1PCh. 10 - Prob. 2PCh. 10 - Prob. 3PCh. 10 - Prob. 4PCh. 10 - Prob. 5PCh. 10 - Prob. 6PCh. 10 - Prob. 7PCh. 10 - Prob. 8PCh. 10 - Prob. 9PCh. 10 - Prob. 10P
Ch. 10 - Prob. 11PCh. 10 - Prob. 12PCh. 10 - Prob. 13PCh. 10 - Prob. 14PCh. 10 - Prob. 15PCh. 10 - Prob. 16PCh. 10 - Prob. 17PCh. 10 - Prob. 18PCh. 10 - Prob. 19PCh. 10 - Prob. 20PCh. 10 - Prob. 21PCh. 10 - Prob. 22PCh. 10 - Prob. 23PCh. 10 - Prob. 24PCh. 10 - Prob. 25PCh. 10 - Prob. 26PCh. 10 - Prob. 27PCh. 10 - Prob. 28PCh. 10 - Prob. 29PCh. 10 - Prob. 30PCh. 10 - Prob. 31PCh. 10 - Prob. 32PCh. 10 - Prob. 33PCh. 10 - Prob. 34PCh. 10 - Prob. 35PCh. 10 - Prob. 36PCh. 10 - Prob. 37PCh. 10 - Prob. 38PCh. 10 - Prob. 39PCh. 10 - Prob. 40PCh. 10 - Prob. 41PCh. 10 - Prob. 42PCh. 10 - Prob. 43P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity topain (congenital pain insensitivity or CPA) and a totallack of the sense of smell (anosmia). The SCN9A geneencodes a sodium channel protein required for transmission of electrical signals from particular nerves inthe body to the brain. The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. Consanguineous matings in three different families have resulted in individuals with CPA/anosmia. In Family 1, a G-to-Atransition in exon 15 results in a truncated protein that is898 amino acids long; in Family 2, deletion of a singlebase results in a 766-amino acid polypeptide; and inFamily 3, a C-to-G transversion in exon 10 yields a458-amino acid protein.a. Hypothesize as to how each of the three SCN9Amutations affects gene structure: Why are truncatedproteins made in each case? b. How would you…arrow_forward. The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age of 70 withamyotrophic lateral sclerosis (ALS), a paralyzing neurodegenerative disease that is usually fatal at a muchyounger age. Recently, geneticists discovered that amajor cause of ALS is the unusual expansion of ahexanucleotide repeat (5′-GGGGCC-3′) that lieswithin a gene called C9ORF72, at a location outside ofthe gene’s open reading frame (ORF). A single expanded allele is sufficient to cause ALS, but the reasonthe disease allele is dominant remains unclear. Someexperimental results support the theory that the allelemakes a toxic RNA containing the expanded repeat. Ifthis theory is correct, in what ways is the mutant ALScausing allele similar to the mutant allele that causesHuntington disease? In what ways is it similar to themutant allele that causes fragile X syndrome?arrow_forwardI. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…arrow_forward
- Cytosine deaminationoccurs ~100 cytosinesper genome per day in a human genome. Eukaryotic cells also contain residues of 5’-methylcytosine, which is involved in regulating gene transcription rates. Mutation of 5’-methylcytosine by deaminationconverts it to thymine. This presents the cell with a much more severe problem than normal cytosine deaminationof cytosine to uracil. Why?arrow_forward7. F. State if/how Remedios' mutation changes the amino acid sequence and describe the effect that change has, if any, on the protein.arrow_forwardHN, NH. NH H2N° А. В. Consider the 3 structures shown. Which of these is (normally) NOT present in either DNA or RNA? (select all that apply) А В none of the above ZI C.arrow_forward
- Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent genes, the "-" represents the centromere of each chromosome, and chromosomes are shown on separate lines. ABCDE-FGHIJK 123-45678 Identify the type of rearrangement shown in each of the following (A-C) and then identify whether it is balanced or unbalanced. Assume that the individual is diploid and heterozygous for the rearrangement. A. • ABCDE-FGHIJKGH 123-45678 Rearrangement: [Select] • Balanced or Unbalanced: [Select] B. • ABCDGF-EHIJK 123-45678 Rearrangement ✓ [Select] • Balanced or Un pericentric inversion Robertsonian translocation deletion tandem duplicate paracentric inversion C. reciprocal translocation ABCDE dispersed duplicate nonreciprocal translocation 123-45arrow_forwardThe intermediates A, B, C, D, E, and F all occur inthe same biochemical pathway. G is the product of thepathway, and mutants 1 through 7 are all G−, meaningthat they cannot produce substance G. The followingtable shows which intermediates will promote growthin each of the mutants. Arrange the intermediates inorder of their occurrence in the pathway, and indicatethe step in the pathway at which each mutant strain isblocked. A + in the table indicates that the strain willgrow if given that substance, an O means lack of growth.SupplementsMutant A B C D E F G1 + + + + + O +2 O O O O O O +3 O + + O + O +4 O + O O + O +5 + + + O + O +6 + + + + + + +7 O O O O + O +arrow_forwardIm stuck on this question:(arrow_forward
- . A geneticist examined the amino acid sequence of aparticular protein in a variety of E. coli mutants. Theamino acid in position 40 in the normal enzyme isglycine. The following table shows the substitutionsthe geneticist found at amino acid position 40 in sixmutant forms of the enzyme.mutant 1 cysteinemutant 2 valinemutant 3 serinemutant 4 aspartic acidmutant 5 argininemutant 6 alanineDetermine the nature of the base substitution thatmust have occurred in the DNA in each case. Whichof these mutants would be capable of recombinationwith mutant 1 to form a wild-type gene?arrow_forwardb. Which one of the following a cell mutants will be able to switch at least once? [Select]arrow_forwardHelp me pleasearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY