Brock Biology of Microorgan. -Access
14th Edition
ISBN: 9780321943736
Author: MADIGAN
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 7RQ
Q Explain why recipient cells do not successfully take up plasmids during natural transformation.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Q. Based on your understanding of plasmids’ answer the following questions.1. Why is a daughter cell that fails to inherit a kind of plasmid dies? 2. How transfer of Col E1 plasmid to an F cell occurs? 3. What component you will must include in constructing a plasmid cloning vector that can replicate in both bacteria and yeast? 4. How copy number of a plasmid may affect its segregation? 5. How the yeast 2u circle maintains 80 copies in a cell?
Explain why recipient cells do not successfully takeup plasmids during natural transformation.
Q11) Explain, using the pCR 2.1 vector, what we would see if we try to grow cells on a plate with ampicillin and Xgal in each of these scenarios:a) transformation not successful (meaning the plasmid did not go inside the bacteria)b) transformation was successful, but no insert in LacZ gene (plasmid went in the bacteria but there was no inserted DNA in the LacZ gene of the plasmid)c) transformation and the ligation reactions were successful (got the plasmid in, and the plasmid is carrying extra DNA in the LacZ region, yay)
Chapter 10 Solutions
Brock Biology of Microorgan. -Access
Ch. 10.1 - Distinguish between a mutation and a mutant.Ch. 10.1 - Distinguish between screening and selection.Ch. 10.2 - Do missense mutations occur in genes encoding...Ch. 10.2 - Why do frameshift mutations generally have more...Ch. 10.3 - Why does the Ames test measure the rate of...Ch. 10.3 - Which class of mutation, missense or nonsense, is...Ch. 10.4 - Prob. 1MQCh. 10.4 - Prob. 2MQCh. 10.4 - Prob. 3MQCh. 10.5 - Prob. 1MQ
Ch. 10.5 - Prob. 2MQCh. 10.5 - Prob. 3MQCh. 10.6 - During transformation a cell usually incorporates...Ch. 10.6 - Prob. 2MQCh. 10.7 - Prob. 1MQCh. 10.7 - What is the major difference between generalized...Ch. 10.7 - Why is phage conversion considered beneficial to...Ch. 10.8 - In conjugation, how are donor and recipient cells...Ch. 10.8 - Explain how rolling circle DNA replication allows...Ch. 10.8 - Prob. 3MQCh. 10.9 - In conjugation involving the F plasmid of...Ch. 10.9 - Prob. 2MQCh. 10.9 - Prob. 3MQCh. 10.10 - Why is it usually more difficult to select...Ch. 10.10 - Why do penicillins not kill species of Archaea?Ch. 10.11 - Prob. 1MQCh. 10.11 - What is the significance of the terminal inverted...Ch. 10.11 - How can transposons be used in bacterial genetics?Ch. 10.12 - Why is the CRISPR system considered a prokaryotic...Ch. 10.12 - Prob. 2MQCh. 10 - Write a one-sentence definition of the term...Ch. 10 - Prob. 2RQCh. 10 - Prob. 3RQCh. 10 - Prob. 4RQCh. 10 - Prob. 5RQCh. 10 - What are heteroduplex regions of DNA and what...Ch. 10 - QExplain why recipient cells do not successfully...Ch. 10 - QExplain how a generalized transducing particle...Ch. 10 - QWhat is a sex pilus and which cell type, F or F+,...Ch. 10 - Prob. 10RQCh. 10 - Prob. 11RQCh. 10 - Prob. 12RQCh. 10 - QExplain why incoming DNA recognized by a short...Ch. 10 - A constitutive mutant is a strain that...Ch. 10 - Although a large number of mutagenic chemicals are...Ch. 10 - Why is it difficult in a single experiment to...Ch. 10 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for delivering into human cells.arrow_forwardCompare the possible differences between a eukaryotic protein-encoding gene cloned by PCR and the same gene cloned by reverse transcriptase PCR (RTPCR).arrow_forwardIdentify mutant genes by plasmid library transformation?arrow_forward
- Q.1. Imagine you are working for a research laboratory and you are asked to help withthe following:a. Cut the following segment of DNA using E. Co R I. Write the sequence offragments clearly and separately. ATTTACGAATTCTTCCAAGAATTCCTAAATGCTTAAGAAGGTTCTTAAGG b. Show sticky ends? How restriction endonuclease are different from the restriction-modification system?arrow_forwardQ.No.4. Describe the critical steps required to make a recombinant bacterial cell for production of commercial products.(subject: Genetic engineering).arrow_forwardDescribe the Ti plasmid binary vector system used in plant transformation and provide details of how this system can be utilized to protect plants against viruses.arrow_forward
- explain the method of Identifying mutant genes by plasmid librarytransformationarrow_forwardWhat type of enzymes are used to “cut” desired DNA sequences for use in recombinant gene technology experiments? Identify those two enzymes used to cut and paste both genes into the plasmid. Identify all three strategies used in this lab to maximize transformation success. Explain what it means for bacteria to be “competent.” Explains why bacterial competency is this important for this investigation.arrow_forwardCompare and discuss the key features of plasmids that are respectively used as bacterial cloning and bacterial expression vectors.arrow_forward
- Give three reasons why liposomes/nanoparticles are attractive drug delivery system for recombinant protein preparations?arrow_forwardDiscuss three stages of TRANSFORMATION and RESTRICTION ANALYSIS OF PLASMID DNA experiment. What happened in each each step, why did we do it and what product was formed?arrow_forwardBriefly describe (in 6-7sentences) what a plasmid is, and how it can be used to transform bacteria like E. coli.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license