GENETIC ANALYSIS: INTEGRATED - ACCESS
GENETIC ANALYSIS: INTEGRATED - ACCESS
3rd Edition
ISBN: 9780135349298
Author: Sanders
Publisher: PEARSON
bartleby

Concept explainers

Question
Book Icon
Chapter 11, Problem 21P
Summary Introduction

To review:

In the given table, there are two DNA and polypeptide sequences shown with alleles for a hypothetical locus that generates different polypeptides of five amino acids. In both cases, the lower DNA strand is the template strand:

GENETIC ANALYSIS: INTEGRATED - ACCESS, Chapter 11, Problem 21P

Based on this data of DNA and polypeptide sequence, is it possible to determine the dominant and recessive allele. Explain with reason.

Introduction:

Genotype is the organism’s genetic makeup while phenotype is that of its observable characters. The alleles are the forms of a gene. A single gene can have either two or many allelic versions.

The dominance or recessive terms state to the inheritance design of certain trait. The dominant alleles will produce dominant phenotype while recessive alleles produce recessive phenotype.

The resultant protein decides whether the trait is dominant or recessive.

Blurred answer
Students have asked these similar questions
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'.   What is the sequence of the partner strand?                                                                                                    4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
Below is a sample of a segment of DNA…(copy from left to right)   3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’   5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’       1.Assume the 6th amino acid is changed from T to G on the DNA template strand.  What type of mutation is this?  What effect would this have on the protein? Look up an example for this type of mutation.    2, Assume the 5th and 6th amino acids are removed from the DNA template strand.  What type of mutation is this? How would this affect the protein?  Look up an example of this type of mutation.    3.Which mutation changes the protein more...a point mutation or a frameshift mutation.  Explain your reasoning.    4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids).    5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this?  If this is on chromosome 4, what genetic disorder is this?…
With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?

Chapter 11 Solutions

GENETIC ANALYSIS: INTEGRATED - ACCESS

Ch. 11 - 11.11 Two different mutations are identified in a...Ch. 11 - What is the phenotype effect of inserting a Ds...Ch. 11 - 11.13 Answer the following questions concerning...Ch. 11 - Several types of mutation are identified and...Ch. 11 - 11.15 A sample of the bacterium is exposed to...Ch. 11 - 11.16 A strain of is identified as having a null...Ch. 11 - Describe the difference between DNA transposons...Ch. 11 - 11.18 How are flanking direct repeat sequences...Ch. 11 - 11.19 Using the adeninethymine base pair in this...Ch. 11 - The partial amino acid sequence of a wild-type...Ch. 11 - Prob. 21PCh. 11 - 11.22 Many human genes are known to have homologs...Ch. 11 - The fluctuation test performed by Luria and...Ch. 11 - In this chapter, three features of genes or of DNA...Ch. 11 - Briefly compare the production of DNA double -...Ch. 11 - During mismatch repair, why is it necessary to...Ch. 11 - 11.27 Following the spill of a mixture of...Ch. 11 - 11.28 In an Ames test using Salmonella bacteria a...Ch. 11 - A wild - type culture of haploid yeast is exposed...Ch. 11 - A fragment of a wild - type polypeptide is...Ch. 11 - Prob. 31PCh. 11 - Alkaptonuria is a human autosomal recessive...Ch. 11 - 11.33 In an experiment employing the methods of...Ch. 11 - Using your knowledge of DNA repair pathways choose...Ch. 11 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 11 - A geneticist searching for mutations uses the...Ch. 11 - 11.37 In a mousebreeding experiment a new mutation...Ch. 11 - 11.38 Considering the Dumbo mutation in a Problem,...Ch. 11 - 11.39 Thinking back to the discussion of...Ch. 11 - 11.40 Common baker’s yeast () is normally grown at...Ch. 11 - 11.41 The two gels illustrated below contain...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education