GENETIC ANALYSIS: INTEGRATED - ACCESS
3rd Edition
ISBN: 9780135349298
Author: Sanders
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 24P
In this chapter, three features of genes or of DNA sequence that contribute to the occurrence of mutational hotspots were described. Identify those three features and briefly describe why they are associated with mutational hotspots.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The following is a list of mutational changes. For each of the specific mutations described, indicate
which of the following terms could apply, either as a description of the mutation or as a possible cause.
More than one term from the right column can apply to each statement in the left column.
1. an A-T base pair in the wild-type gene is
changed to a G-C pair
2. an A-T base pair is changed to a T-A pair
a. transition
b. base substitution
c. transversion
3. the sequence AAGCTTATCG is changed to
d. inversion
AAGCTATCG
c. translocation
f. deletion
4. the sequence AAGCTTATCG is changed to
AAGCTTTATCG
g. insertion
5. the sequence AACGTTATCG is changed to
AATGTTATCG
h. decamination
6. the sequence AACGTCACACACACATCG is i. X-ray irradiation
changed to AACGTCACATCG
j. intercalator
7. the gene map in a given chromosome arm is
changed from bog-rad-fox1-fox2-try-duf
(where foxl and fox2 are highly homologous,
recently diverged genes) to bog-rad-fox1-fox3-
fox2-try-duf (where fox3 is a new gene…
There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation.
Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE.
Likewise, fill in the columns that contain a missense mutation with RED.
Shade any columns that contain nonsense mutations with GREEN.
Then
Of the five mutations you identified in the mutant Mc1r gene, how many are:
substitutions insertions deletions (Enter a number on each line.)
2. Of the five mutations…
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages provideanswers for the following questions?1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?
Chapter 11 Solutions
GENETIC ANALYSIS: INTEGRATED - ACCESS
Ch. 11 - 11.1 Identify two general ways chemical mutagens...Ch. 11 - 11.2 Nitrous acid and (BU) alter DNA by different...Ch. 11 - 11.3 What is the difference between a transition...Ch. 11 - What is the difference between a synonymous...Ch. 11 - 11.5 UV irradiation causes damage to bacterial...Ch. 11 - Ultraviolet (UV) radiation is mutagenic.
What...Ch. 11 - Researchers interested in studying mutation and...Ch. 11 - The effect of base - pair substitution mutations...Ch. 11 - Describe the purpose of the Ames test. How are...Ch. 11 - 11.10 In numerous population studies of...
Ch. 11 - 11.11 Two different mutations are identified in a...Ch. 11 - What is the phenotype effect of inserting a Ds...Ch. 11 - 11.13 Answer the following questions concerning...Ch. 11 - Several types of mutation are identified and...Ch. 11 - 11.15 A sample of the bacterium is exposed to...Ch. 11 - 11.16 A strain of is identified as having a null...Ch. 11 - Describe the difference between DNA transposons...Ch. 11 - 11.18 How are flanking direct repeat sequences...Ch. 11 - 11.19 Using the adeninethymine base pair in this...Ch. 11 - The partial amino acid sequence of a wild-type...Ch. 11 - Prob. 21PCh. 11 - 11.22 Many human genes are known to have homologs...Ch. 11 - The fluctuation test performed by Luria and...Ch. 11 - In this chapter, three features of genes or of DNA...Ch. 11 - Briefly compare the production of DNA double -...Ch. 11 - During mismatch repair, why is it necessary to...Ch. 11 - 11.27 Following the spill of a mixture of...Ch. 11 - 11.28 In an Ames test using Salmonella bacteria a...Ch. 11 - A wild - type culture of haploid yeast is exposed...Ch. 11 - A fragment of a wild - type polypeptide is...Ch. 11 - Prob. 31PCh. 11 - Alkaptonuria is a human autosomal recessive...Ch. 11 - 11.33 In an experiment employing the methods of...Ch. 11 - Using your knowledge of DNA repair pathways choose...Ch. 11 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 11 - A geneticist searching for mutations uses the...Ch. 11 - 11.37 In a mousebreeding experiment a new mutation...Ch. 11 - 11.38 Considering the Dumbo mutation in a Problem,...Ch. 11 - 11.39 Thinking back to the discussion of...Ch. 11 - 11.40 Common baker’s yeast () is normally grown at...Ch. 11 - 11.41 The two gels illustrated below contain...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. answers for the following questions?2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?arrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forward
- Two types of mutations discussed in this chapter are nucleotide changes and unstable genome regions that undergo dynamic change. Describe each type of mutationarrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)arrow_forward
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?arrow_forwardHuntington disease (HD) can arise from a rare, short, in-frame addition of CAG nucleotide triplets within the huntingtin (HTT) gene coding region, which creates a disease-causing allele with the symptoms only appearing later in life. Using this information, describe an experiment that could be undertaken to determine whether a currently healthy young individual is a carrier of the HD-causing mutation. Describe the method you would use and how you would interpret the results of this experiment.arrow_forward
- Leber Congenital Amaurosis (LCA) causes progressive vision loss due to defects in the gene that encodes RPE65 isomerase. Affected individuals are homozygous recessive for mutant alleles of the RPE65 gene. You are trying to determine the molecular nature of the mutations in three individuals with LCA. For ease of analysis, you may assume that each individual is homozygous for the same mutant allele (though the three individuals have different mutations than each other). You use the polymerase chain reaction to amplify DNA from each patient and you determine the sequence of the DNA and compare it to unaffected individuals. You identify the following differences. Note that the non-template strand of DNA is given and the changes are highlighted using red boldface. You can assume that the sequences are in the first reading frame (eg. the first three nucleotides of each sequence is a codon). The coding region of the gene is 1602 bp and the position of the sequences shown below is…arrow_forwardThe accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)arrow_forwarda. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY