GENETIC ANALYSIS: AN INTEG. APP. W/MAS
2nd Edition
ISBN: 9781323142790
Author: Sanders
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 3P
Bacterial DNA is compacted by two principal mechanisms. Identify and briefly describe each mechanism.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
a) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences.
b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.
Describe the mechanisms by which bacterial DNA becomes compacted.
For each of the following ( A & B ) provide the method of transfer and a brief explanation as to why the method would not take place under the conditions described . 1. Which method of DNA transfer between bacteria would not take place if the donor and recipient were separated by a filter with a pore size of 0.45 um or another physical barrier 2. Which method of transfer would be blocked by the presence of high concentrations of DNAase ( enzymes capable of degrading DNA ) ?
Chapter 11 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
Ch. 11 - Prob. 1PCh. 11 - Prob. 2PCh. 11 - Bacterial DNA is compacted by two principal...Ch. 11 - 10.2 The human genome contains contains base...Ch. 11 - 10.1 Give descriptions for the following...Ch. 11 - 10.4 Describe the importance of light and dark G...Ch. 11 - In eukaryotic DNA, Where are you most likely to...Ch. 11 - Prob. 8PCh. 11 - Human late prophase karyotypes have about 2000...Ch. 11 - 10. What are the two or three most essential...
Ch. 11 - Prob. 11PCh. 11 - Prob. 12PCh. 11 - A researcher interested in studying a human gene...Ch. 11 - Prob. 14PCh. 11 - 10.11 In what way does position effect variegation...Ch. 11 - 16. What are chromosome territories, and what...Ch. 11 - Prob. 17PCh. 11 - Prob. 18PCh. 11 - 10.18 A survey of organisms living deep in the...Ch. 11 - A eukaryote with a diploid number of 2n=6 carries...Ch. 11 - The accompanying chromosome diagram represents a...Ch. 11 - Suppose the genome of a bacterium contains a...Ch. 11 - DNaseI cuts DNA that is not directly associated...Ch. 11 - 10.17 Histone protein isolated from pea plants...Ch. 11 - 25. The molecular probes used in FISH can detect...Ch. 11 - Experimental evidence demonstrates that the...Ch. 11 - Prob. 27PCh. 11 - Genomic DNA from the nematode worm...Ch. 11 - What function do histone proteins perform in...Ch. 11 - Based on discussions of specific proteins and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Deamination of cytosine to form uracil can happen spontaneously during replication. It can be repaired relatively easily by photoreactivation repair using DNA polymerase I b) base excision repair using DNA glycosylase creating an AP site c) base excision repair using topoisomerase creating an AP site d) none of thesearrow_forwardDescribe the excision repair process in DNA, using the excision of thymine dimers as an example.arrow_forwardAnswer the following questions: 1. Which sequence has a purine base at the 3' end? A) TCTAG B) AUCCT C) GUGCCU D) CCTTC 2. Select a choice that does not describe a lagging strand: A) Has a polynucleotide product in a 5' to 3' direction B) Being produced away from the replication fork C) Complementary strand based on a template strand in 5' and 3' direction D) Composed of multiple RNA primers 3. Which of the following is not observed during elongation process in DNA replication? A) Helicase B) DNA Pol C) Primase D) Okazaki fragmentsarrow_forward
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardTRUE OR FLASE a) DNA positively supercoils during replication and negatively supercoils in transcription. b) The proteins and other substances that bind to the DNA rely mostly on covalent interaction to deliver the effects on the DNA.arrow_forwardThe following sequence represents a few codons present in one strand of DNA.Using this strand of DNA as a template strand for transcription, you are required to synthesize a new RNA strand. A) Show the codons that will be present on the RNA strand. B) Using the universal genetic code, provide the amino acids on the protein that will be translated from the RNA strand. 3’ TAC ATG GTT GTG CTA ATT 5’arrow_forward
- A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed orange lines. a) Which Okazaki fragment was made first, A, B, or C? b) When ligase joins fragments A and B, will it act at arrow 1, 2, or both?arrow_forwardIn standard agarose gels used for the analysis of DNA, linear DNA fragments are separated on the basis of their... a) Size b) Charge c) Buoyancy d) Color e) Smellarrow_forwardUse a drawing to illustrate the principle of DNA gel electrophoresis. (2 marks)-+arrow_forward
- Deamination of adenine results in the formation of hypoxanthine. Hypoxanthine selectively base pairs with cytosine. If this error is not corrected, what base pair can the original A·T base pair be converted to after cycles of DNA replication?a) G·C b) C·G c) T·A d) A·Garrow_forwardThe BamH1 enzyme comes at a concentration of 100,000 U/ml. You are asked to digest 20 ug of DNA with this enzyme. Determine: a) How many units will you need? b) How will you dispense them?arrow_forwardDescribe the function of the following reagents used in the DNA extraction procedure?a) Proteinase K b) 5M Nacl c) Isopropanol d) 1X TE Bufferarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY