EP CONNECT ONLINE ACCESS FOR BIOLOGY:
5th Edition
ISBN: 9781260542226
Author: Hoefnagels
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Question
Chapter 11, Problem 5MCQ
Summary Introduction
Introduction:
DNA or deoxyribonucleic acid is the hereditary material that is present in all the organisms.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following represents the sequence of an RNA transcript for which the template strand of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written
5'-3'.
DA. GUACUGGCUAGCUGCUAGAA
B. UUCUAGCAGCUAGCCAGUAC
с. ТТСТАGCAGCTAGCCAGTАС
D. GTACTGGCТAGCTGCTAGAА
A mutant DNA strand was transcribed then translated to proteins.
a. What is the protein product of the mutant DNA strand?
The sequence of the mutant strand is shown below:
5'-TGCCATAACTGTTCGTACTGGCAAATTGCC-3'
3'-ACGGTATTGACAAGCATGACCGTTTAACGG-5'
b. The mutation altered the sequence of the wild type template DNA such
that a degenerate codon for a basic amino acid in the wild type was
converted to a non-degenerate codon resulting in the sequence for the
mutant strand shown. What was the original amino acid?
c. Compare the charges and pl of the mutant peptide and the normal (wild-
type) peptide at physiological pH?
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA?
a. UUAGCCGACCCUAAU
b. AAUCGGCUGGGAUUA
c. TTAGCCGACCCTAAT
d. UUTCGGCTGGGUTTU
2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA?
a. leucine - alanine - aspartic acid - serine - aspagarine
b. leucine - threonine - aspartic acid - serine - aspagarine
c. leucine - alanine - aspartic acid - proline
- aspagarine
d. tyrosine - alanine - aspartic acid - proline
- aspartic acid
3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC?
a. addition
b. deletion
c. insertion
d. subtitution
4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon?
a. isoleucine
b. leucine
c. tyrosine
d. trytophan
5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC?
a. addition
b. deletion
c. insertion
d. substitution
Chapter 11 Solutions
EP CONNECT ONLINE ACCESS FOR BIOLOGY:
Ch. 11.1 - Prob. 1MCCh. 11.1 - Prob. 2MCCh. 11.2 - What are some uses for transgenic organisms?Ch. 11.2 - Prob. 2MCCh. 11.2 - Prob. 3MCCh. 11.2 - What is the function of the 98.5% of the human...Ch. 11.2 - How does PCR work, and why is it useful?Ch. 11.2 - Prob. 6MCCh. 11.2 - Why do investigators sometimes analyze...Ch. 11.3 - Prob. 1MC
Ch. 11.3 - Prob. 2MCCh. 11.3 - Summarize the steps scientists use to clone an...Ch. 11.3 - Prob. 4MCCh. 11.4 - Prob. 1MCCh. 11.4 - Prob. 2MCCh. 11.4 - Prob. 3MCCh. 11.4 - Prob. 4MCCh. 11.4 - What are some examples of ethical questions raised...Ch. 11.5 - Prob. 1MCCh. 11.5 - Prob. 2MCCh. 11 - If a restriction enzyme cuts between the G and the...Ch. 11 - Which of the following is not a reason that...Ch. 11 - Prob. 3MCQCh. 11 - Prob. 4MCQCh. 11 - Prob. 5MCQCh. 11 - Prob. 6MCQCh. 11 - Prob. 7MCQCh. 11 - What techniques might researchers use to create...Ch. 11 - Prob. 2WIOCh. 11 - Prob. 3WIOCh. 11 - Prob. 4WIOCh. 11 - Why are entire genomes not used for DNA profiling?Ch. 11 - In a 2013 investigation, researchers discovered...Ch. 11 - Unneeded genes in an adult animal cell are...Ch. 11 - Prob. 8WIOCh. 11 - Prob. 9WIOCh. 11 - Prob. 10WIOCh. 11 - If a cells genome is analogous to a cookbook and a...Ch. 11 - Prob. 12WIOCh. 11 - Review the Survey the Landscape figure in the...Ch. 11 - How does PCR relate to DNA profiling and...Ch. 11 - Add the terms restriction enzyme, plasmid, virus,...
Knowledge Booster
Similar questions
- Look at the amino acid chart below that the proctor placed on a board at the front of the classroom before asking the students questions. Help Arcel characterize the DNA mutation (HbS) according to its amino acid and position. a The disease is caused by GAG20→GTG20. b The disease is caused by val6→gln6. c The disease is caused by glu6→ val6. d The disease is caused by glu20→ val20.arrow_forwardChoose the combination of answers that most accurately completes the statement.Which of the following sequences, when combined with its complement, would be clipped by a restriction endonuclease? a. ATCGATCGTAGCTA c. GAATTC b. AAGCTTCGAA d. ACCATTGGAarrow_forwardThe chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'arrow_forward
- Which of the following sequences, when combined with itscomplement, would be clipped by a restriction endonuclease?a. ATCGATCGTAGCTA b. AAGCTTCGAA c. GAATTC d. ACCATTGGAarrow_forwardGiven Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’ a. Complementary Strand b. Direct Transcript c. Transcript for Translation d. Amino Acid Sequence or Translation:arrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forward
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardA DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this, what is the nucleotide sequence of the MRNA strand that is transcribed? a. TGC AAA TAC CCA b. UGC AAA UAC CCA C. AGC UUU AUC CCU d. ACG UUU AUG GGUarrow_forwardA DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this, what is the nucleotide sequence of the MRNA strand that is transcribed? a. ATC CAA GÁC TGG b. TAG GTT CTG ACC c. UAG GUU CUG ACC d. AUC CAA GÁC UGGarrow_forward
- The following DNA sequence was determined by Sanger sequencing, using a 20 nt long sequencing primer that ended ...AGTACAACAA-3'. 5'-agtacaacaa ctctcggtc tacggtacgc ctgcgggcgc gtagccaatc tagcacttcg-3' 3'-tcatgttgtt gagagccag atgccatgcg gacgcccgcg catcggttag atcgtgaagc-5′ A. If the technician forgot to add ddNTPs to the reaction, what would the sequencing chromatogram look like? Blank Many peaks, but only one at each position Overlapping peaks at every position All peaks are black There is only one peak, at 60 nt B.When the reaction is done correctly, ddCTP is labeld with a yellow fluorescent tag. When the Sanger sequencing reaction is complete, what will be the lengths, in nucleotides, of the three shortest products that have the yellow tag? C. Could you perform Illumina sequencing using ddNTPs? Why or why not? Explain.arrow_forwardA DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACTarrow_forwardFor the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTATarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education