EBK BROCK BIOLOGY OF MICROORGANISMS
15th Edition
ISBN: 8220103633352
Author: Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.6, Problem 1CR
Q Explain why recipient cells do not successfully take up plasmids during natural transformation.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Q. What is the total size of your recombinant plasmid vector containing the insert?
give answer asap
Q. The diagram is given below shows conjugation between F + or Hfr donor cells with F-recipient cells. On the basis of this diagram, answer the following questions.1. How you will differentiate between an F + and an Hfr strain? 2. Among two strains, which type of strain do you expect to transfer bacterial genes to F-cells? 3. What may be the end status of both donor and recipient cells of F plasmid-mediated conjugation? 4. What may be the end result when Hfr conjugates with F- cell?
Explain why recipient cells do not successfully takeup plasmids during natural transformation.
Chapter 11 Solutions
EBK BROCK BIOLOGY OF MICROORGANISMS
Ch. 11.1 - Distinguish between a mutation and a mutant.Ch. 11.1 - Distinguish between screening and selection.Ch. 11.1 - Prob. 3MQCh. 11.1 - Write a one-sentence definition of the term...Ch. 11.2 - Do missense mutations occur in genes encoding...Ch. 11.2 - Why do frameshift mutations generally have more...Ch. 11.2 - Prob. 1CRCh. 11.3 - Why are suppressor tRNA mutations not lethal?Ch. 11.3 - Which class of mutation, missense or nonsense, is...Ch. 11.3 - What is the difference between same-site and...
Ch. 11.4 - Prob. 1MQCh. 11.4 - Prob. 2MQCh. 11.4 - Prob. 1CRCh. 11.5 - Which protein, found in virtually all cells,...Ch. 11.5 - Explain the fate of transferred chromosomal DNA if...Ch. 11.5 - Prob. 3MQCh. 11.5 - What are heteroduplex regions of DNA and what...Ch. 11.6 - During transformation a cell usually incorporates...Ch. 11.6 - In genetic transformation, what is meant by the...Ch. 11.6 - QExplain why recipient cells do not successfully...Ch. 11.7 - Prob. 1MQCh. 11.7 - What is the major difference between generalized...Ch. 11.7 - Why is phage conversion considered beneficial to...Ch. 11.7 - QExplain how a generalized transducing particle...Ch. 11.8 - In conjugation, how are donor and recipient cells...Ch. 11.8 - Explain how rolling circle DNA replication allows...Ch. 11.8 - QWhat is a sex pilus and which cell type, F or F+,...Ch. 11.9 - In conjugation involving the F plasmid of...Ch. 11.9 - Prob. 2MQCh. 11.9 - Prob. 3MQCh. 11.9 - QWhat is a merodiploid and how does an F plasmid...Ch. 11.10 - Why is it usually more difficult to select...Ch. 11.10 - Why do penicillins not kill species of Archaea?Ch. 11.10 - Explain one type of conjugation in Archaea and how...Ch. 11.11 - Prob. 1MQCh. 11.11 - What is the significance of the terminal inverted...Ch. 11.11 - How can transposons be used in bacterial genetics?Ch. 11.11 - Prob. 1CRCh. 11.12 - Why is the CRISPR system considered a prokaryotic...Ch. 11.12 - Prob. 2MQCh. 11.12 - QExplain why incoming DNA recognized by a short...Ch. 11 - A constitutive mutant is a strain that...Ch. 11 - Although a large number of mutagenic chemicals are...Ch. 11 - Why is it difficult in a single experiment to...Ch. 11 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- . Explain the basis for the following statement: Transcription of two genes on a plasmid can occur without the concomitant action of a topoisomerase, but only if those two genes are oriented in opposite directions.arrow_forwardExplain the THREE (3) important regions of this plasmid that enable it to work efficiently as a cloning vector?arrow_forward.Describe the method you would use to test for the uptake of a plasmid with a DNA insertarrow_forward
- A.How could endonucleases interfere with the transformation procedure? B. Does supercoiled or nicked plasmid get transformed more efficiently? Why?arrow_forwardGive three reasons why liposomes/nanoparticles are attractive drug delivery system for recombinant protein preparations?arrow_forwardExplain the importance of competence in natural and artificial bacterial transformation. Explain the effect of COM-blockers on bacterial transformation and their application in controlling drug resistance.arrow_forward
- Describe the rationale behind the electrophoretic mobility shift assay.arrow_forwardConsider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for delivering into human cells.arrow_forwardGive practical applications of UV mutagenesis. In industry, cite examples of microorganisms improved by UV radiation. Since UV light is used for germicidal purposes, cite some limitations for its use.arrow_forward
- Explain why rolling circle replication of plasmids is semi-conservative.arrow_forwardDefine about Taq polymerase ?arrow_forwardE23. In the Western blot shown here, proteins were isolated from red blood cells and muscle cells from two different individuals. One individual was unaffected, and the other suffered from a disease known as thalassemia, which involves a defect in hemoglobin. The blot was exposed to an antibody that recognizes B globin, which is one of the polypeptides that constitute hemoglobin. Equal amounts of total cellular proteins were added to each lane. Lane 1: Proteins isolated from normal 2 3 4 red blood cells Lane 2: Proteins isolated from the red blood cells of a thalassemia patient Lane 3: Proteins isolated from normal muscle cells Lane 4: Proteins isolated from the muscle cells of a thalassemia patient Explain these results.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license