EBK BROCK BIOLOGY OF MICROORGANISMS
15th Edition
ISBN: 8220103633352
Author: Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.8, Problem 2MQ
Explain how rolling circle
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Describe the similarities and differences between abacterial chromosome and a plasmid
List three differences between a plasmid and a chromosome
Explain how rolling circle DNA replication allows both donor andrecipient to end up with a complete copy of plasmids transferredby conjugation.
Chapter 11 Solutions
EBK BROCK BIOLOGY OF MICROORGANISMS
Ch. 11.1 - Distinguish between a mutation and a mutant.Ch. 11.1 - Distinguish between screening and selection.Ch. 11.1 - Prob. 3MQCh. 11.1 - Write a one-sentence definition of the term...Ch. 11.2 - Do missense mutations occur in genes encoding...Ch. 11.2 - Why do frameshift mutations generally have more...Ch. 11.2 - Prob. 1CRCh. 11.3 - Why are suppressor tRNA mutations not lethal?Ch. 11.3 - Which class of mutation, missense or nonsense, is...Ch. 11.3 - What is the difference between same-site and...
Ch. 11.4 - Prob. 1MQCh. 11.4 - Prob. 2MQCh. 11.4 - Prob. 1CRCh. 11.5 - Which protein, found in virtually all cells,...Ch. 11.5 - Explain the fate of transferred chromosomal DNA if...Ch. 11.5 - Prob. 3MQCh. 11.5 - What are heteroduplex regions of DNA and what...Ch. 11.6 - During transformation a cell usually incorporates...Ch. 11.6 - In genetic transformation, what is meant by the...Ch. 11.6 - QExplain why recipient cells do not successfully...Ch. 11.7 - Prob. 1MQCh. 11.7 - What is the major difference between generalized...Ch. 11.7 - Why is phage conversion considered beneficial to...Ch. 11.7 - QExplain how a generalized transducing particle...Ch. 11.8 - In conjugation, how are donor and recipient cells...Ch. 11.8 - Explain how rolling circle DNA replication allows...Ch. 11.8 - QWhat is a sex pilus and which cell type, F or F+,...Ch. 11.9 - In conjugation involving the F plasmid of...Ch. 11.9 - Prob. 2MQCh. 11.9 - Prob. 3MQCh. 11.9 - QWhat is a merodiploid and how does an F plasmid...Ch. 11.10 - Why is it usually more difficult to select...Ch. 11.10 - Why do penicillins not kill species of Archaea?Ch. 11.10 - Explain one type of conjugation in Archaea and how...Ch. 11.11 - Prob. 1MQCh. 11.11 - What is the significance of the terminal inverted...Ch. 11.11 - How can transposons be used in bacterial genetics?Ch. 11.11 - Prob. 1CRCh. 11.12 - Why is the CRISPR system considered a prokaryotic...Ch. 11.12 - Prob. 2MQCh. 11.12 - QExplain why incoming DNA recognized by a short...Ch. 11 - A constitutive mutant is a strain that...Ch. 11 - Although a large number of mutagenic chemicals are...Ch. 11 - Why is it difficult in a single experiment to...Ch. 11 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences. b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.arrow_forwardAssume that there are horizontal gene transfers between two completely different bacterial species. In one case it is a plasmid that is transmitted via conjugation, in the other case it is it is a part of the bacterial chromosome that is transferred via transformation. In which of the two cases is it likely that the transferred DNA will be present? left and can function in the recipient cells? Explain the biological background to your answerarrow_forwardWhich of the following is NOT a mechanism by which plasmids inerease the possibility of being present in the new generation of cells? A) O They can be present at a high number so that some copies will end up in each new cell after cell division. B) O They encode traits such as antibiotic resistance that are required for growth in some environments. C) O They cause the cell to replicate much more rapidly than cells that do not have plasmids. D) O They may carry host survival genes and self-preservation genes.arrow_forward
- Consider a hypothetical phage whose DNA replicates exclusively by rolling circle replication. A phage with radioactive DNA in both strands infects a bacterium and is allowed to replicate in a nonradioactive medium. Assume that only daughter DNA from the elongated branch ever gets packaged into progeny particles. What fraction of the parental radioactivity will appear in the progeny phage? How many progeny phage will contain radioactive DNA? What is the fundamental difference between the initiation of θ replication and that of the rolling circle?arrow_forwarddraw structure of plasmidarrow_forwardIn the scenario where a single strand break occurs in the DNA replication fork: a) What would happen if RecC failed to bind to the chi site? Explain briefly and draw out the step at which recombinational DNA repair would stall. b) What would happen if RecA failed to bind DNA? Explain briefly and draw out the step at which recombinational DNA repair would stall. c) Draw the resolved product of this Holliday junction if it's cleaved in the direction of the white triangles. Is the result a heteroplex or recombinant? A Strand Invasion Ⓒ Holliday Junction A Resolvearrow_forward
- Explain the concept of semiconservative replication and how simultaneous copying of both strands of DNA is accomplished in prokaryotic cells.arrow_forwardDuring mating of an Hfr bacterial cell with a neighboring F-bacterial cell, the sigma mode of plasmid DNA replication ensues. This mating will likely result in which of the following cell types: Anewers A-E 1 F and 1 F- B 2F- C 1F-and 1 Hfr D 1 F+ and 1F E 2 Hfrarrow_forwardHigh Frequency Recombination results in which of the following? O 1) Plasmid DNA incorporated into the cell 2) Genomic DNA incorporated into the cell 3) Viral DNA incorporated into the cell 4) Plasmid and genomic DNA from the donor cell is incorporated into the recipient cell's genome 5) The movement of genes within the cell through homologous recombinationarrow_forward
- Explain the following statement : a) initiation of bacteriall DNA replication is an energy requiring process b) bacterial DNA polymerase can enter the termination sequence but cannot exisarrow_forwardIn DNA replication, the role of topoisomerase is to Question 11 options: a) "unzip" the double stranded DNA in front of DNA polymerase. b) maintain the single stranded DNA. c) supercoil the DNA after the replication fork has passed. d) relieve supercoil tension in the DNA in front of the replication fork.arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license