Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 12, Problem 10TY
Summary Introduction
Introduction: The initiation of translation requires the binding of the complementary mRNA codon with the anticodon of the tRNA. Hence, tRNA serves as the translator of various codons into the amino acid. The amino acid synthesis begins with the binding of tRNA with mRNA at three sites. The elongation stage of translation is followed by the termination phase of the translation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which statement regarding UTRs is TRUE?
a) Transcription begins at the start of the 5' UTR
b) Translation begins at the start of the 5' UTR
c) The 5' and 3' UTRs are spliced from the mRNA transcript
d) The translation stop codon is found downstream of the 3' UTR
What is the role of transcription in the determination of the amino acid sequence of a polypeptide chain?
A.
It pairs anticodons and codons.
B.
It synthesizes an mRNA strand.
C.
It duplicates the information in DNA.
D.
It decodes the information from mRNA.
What regulates the process of transcription and translation; compare and contrast these processes.
Chapter 12 Solutions
Biology
Ch. 12.1 - What disease would result if a person inherited...Ch. 12.1 - Prob. 2CCCh. 12.1 - What is the direction of flow of genetic...Ch. 12.2 - Core Skill: Connections Look back at the role of...Ch. 12.3 - Prob. 1CCCh. 12.4 - Prob. 1CCCh. 12.4 - Prob. 1EQCh. 12.4 - Prob. 2EQCh. 12.4 - Prob. 3EQCh. 12.5 - Core Skill: Connections Look back at Figure 6.3,...
Ch. 12.5 - Prob. 2CSCh. 12.6 - Prob. 1CCCh. 12 - Which of the following best represents the central...Ch. 12 - A mutation prevents a gene from being transcribed...Ch. 12 - Prob. 3TYCh. 12 - Prob. 4TYCh. 12 - If a eukaryotic mRNA failed to have a cap attached...Ch. 12 - Prob. 6TYCh. 12 - Prob. 7TYCh. 12 - During the initiation of translation, the first...Ch. 12 - Prob. 9TYCh. 12 - Prob. 10TYCh. 12 - Prob. 1CQCh. 12 - Prob. 2CQCh. 12 - Prob. 3CQCh. 12 - Prob. 1COQCh. 12 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which statement is true of the translocation phase of elongation during protein synthesis? a. The empty tRNA moves to the A site of the ribosomal complex. b. The empty tRNA moves to the T site of the ribosomal complex. c. The dipeptide moves from the A site to the P site of the ribosomal complex. d. The dipeptide moves from the P site to the A site of the ribosomal complex.arrow_forwardThe law of complementary base pairingdescribes the way the bases in an mRNAcodon pair up with the bases of a tRNAanticodon during translation.arrow_forwarda. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequencearrow_forward
- Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?arrow_forwardRefer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?arrow_forwardA scientist isolates some mRNA from one gene and compares its sequence to that of the gene from which it was copied. Where will the mRNA be found to end? A. at the promoter B. at an intron C. at the stop codon D. at an enhancerarrow_forward
- What is meant by the term DNA replication? a. synthesis of nucleotides b. cell division c. interpretation of the genetic code d. the exact copying of the DNA code into two new moleculesarrow_forwardWhat happened when a ribosome reaches a stop codon on the mRNA ?arrow_forward1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.arrow_forward
- How are rare bases incorporated into tRNAs? a. Encoded by guide RNAs b. By chemical changes to one of the standard bases c. Encoded by rare bases in DNA d. Encoded by sequences in intronsarrow_forwardWhat is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your own words, explain what this enzyme does.arrow_forwardAfter RNA polymerase binds to DNA, it begins making mRNA. What is the name of this process?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license