Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 5TY
If a eukaryotic mRNA failed to have a cap attached to its 5′ end, what would the negative consequence(s) be?
- a. The mRNA would not properly exit the nucleus.
- b. The mRNA would not properly bind to a ribosome.
- c. The mRNA would not receive a poly A tail.
- d. The mRNA would not use the correct start codon.
- e. both a and b
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
In a polyribosome, the polypeptides associated with which ribosomes will be the longest?
a. Those at the 5′ end of mRNA
b. Those at the 3′ end of mRNA
c. Those in the middle of mRNA
d. All polypeptides will be the same length.
If a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be?
I chose b and got this questions wrong, why is this wrong?
a.
The mRNA would not properly exit the nucleus.
b.
The mRNA would not properly bind to a ribosome.
c.
The mRNA would not receive a poly A tail.
d.
The mRNA would not use the correct start codon.
e.
Both a and b are correct.
Chapter 12 Solutions
Biology
Ch. 12.1 - What disease would result if a person inherited...Ch. 12.1 - Prob. 2CCCh. 12.1 - What is the direction of flow of genetic...Ch. 12.2 - Core Skill: Connections Look back at the role of...Ch. 12.3 - Prob. 1CCCh. 12.4 - Prob. 1CCCh. 12.4 - Prob. 1EQCh. 12.4 - Prob. 2EQCh. 12.4 - Prob. 3EQCh. 12.5 - Core Skill: Connections Look back at Figure 6.3,...
Ch. 12.5 - Prob. 2CSCh. 12.6 - Prob. 1CCCh. 12 - Which of the following best represents the central...Ch. 12 - A mutation prevents a gene from being transcribed...Ch. 12 - Prob. 3TYCh. 12 - Prob. 4TYCh. 12 - If a eukaryotic mRNA failed to have a cap attached...Ch. 12 - Prob. 6TYCh. 12 - Prob. 7TYCh. 12 - During the initiation of translation, the first...Ch. 12 - Prob. 9TYCh. 12 - Prob. 10TYCh. 12 - Prob. 1CQCh. 12 - Prob. 2CQCh. 12 - Prob. 3CQCh. 12 - Prob. 1COQCh. 12 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?arrow_forwardIf a human gene is found to contain five introns, the mature mRNA encoded by that gene would have how many exons? a) four exons b) five exons c) six exons d) there could be multiple mRNA that contain between one and six exonsarrow_forwardWhat is the genetic code? a. The relationship between a three-base codon sequence and an amino acid or the end of translation b. The entire base sequence of an mRNA molecule c. The entire sequence from the promoter to the terminator of a gene d. The binding of tRNA to mRNAarrow_forward
- When would a ribosome bind to a promoter sequence? A) It wouldn't. A promoter is a DNA sequence, and ribosomes don't bind to DNA. B) When the ribosome needs to transcribe the gene that that promoter controls. C) When the ribosome is translating the DNA sequence of a gene. D) When there is a start codon (AUG) in the promoter sequence. .arrow_forwardWhich of the following best describes mRNA?Group of answer choices a) Complexes with ribosomal proteins to form ribosomes b) Transports amino acids to ribosomes during translation c) Provides the instructions for the amino acid sequence of a polypeptide d) Used for eukaryotic RNA processingarrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forward
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardThe Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of the start codon in bacteria. c. the site in the mRNA where translation ends. d. how fast the mRNA is translated.arrow_forwardEukaryotic mRNA is capped at the 5' end by: a. adding a poly A sequence to the 5' end. b. ligating a 7-methylguanylate via a 3’ linkage. c. methylating the base pairs near the 5’ end. d. forming a lariat structure via transesterification.arrow_forward
- A scientist studies the production of a key digestive enzyme in silk moths. The moths have one gene for this enzyme, and the scientist extracts mRNA transcribed from this gene as well as protein translated from it. The gene has three introns in its sequence. If the researcher compares mRNA from inside the nucleus to mRNA from the ribosomes, what will be found? A. less mRNA in the nucleus B. shorter mRNA in the ribosomes C. identical mRNAs in both places D. mRNA covalently attached to protein in the nucleusarrow_forwardIf you imagine a messenger RNA molecule in the cytoplasm of a cell, which of the following will likely affect how much protein is made by translation of this message? A. The presence of appropriate snRNPs. B. The length of the polyA tail. C. The strength of hydrogen bonds holding the mRNA to ribosomal RNA. D. The ability of the mRNA to pair with itself to form a helix-turn-helix structure.arrow_forwardTranslation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY