EBK CONCEPTS OF GENETICS
12th Edition
ISBN: 9780134818979
Author: Killian
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 24ESP
Following is a diagram of the general structure of the bacteriophage λ chromosome. Speculate on the mechanism by which it forms a closed ring upon infection of the host cell.
5′ GGGCGGCGACCT—double-stranded region—3′
3′—double-stranded region—CCCGCCGCTGGA 5′
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Describe the structure and location of a D-loop.
Below is a depiction of a replication bubble.
5' AGCTCCGATCGCGTAACTTT
3'
TCGAGGCTAGCGCATTGAAA
CTAAAGCTTCGGGCATTATCG 3'
GATTTCGAAGCCCGTAATAGC
TATCGACS
Consider the following primer which binds to the DNA replication bubble on the diagram above:
5'-GCUAUCG-3'
Identify the DNA sequence to which this primer would bind and the orientation.
If the replication fork moves to the right, will the primer be used to create the leading strand of replication
or the lagging strand? Explain your answer
b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or
a.
the lagging strand? Explain your answer.
What would the next five nucleotides added to the primer by DNA polymerase?
С.
Given the diagram of the replication fork below,
indicate the chemical group (5'-P, 3'-P, 3'-OH or 5'-OH)
most likely to be found at the sites indicated below by the dots labeled A, B, and C.
Chapter 12 Solutions
EBK CONCEPTS OF GENETICS
Ch. 12 - In bacteriophages and bacteria, the DNA is almost...Ch. 12 - After salivary gland cells from Drosophila are...Ch. 12 - If a human nucleus is 10 m in diameter, and it...Ch. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - Prob. 2CSCh. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 12 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 12 - Contrast the size of the single chromosome in...Ch. 12 - Describe the structure of giant polytene...
Ch. 12 - What genetic process is occurring in a puff of a...Ch. 12 - During what genetic process are lampbrush...Ch. 12 - Why might we predict that the organization of...Ch. 12 - Describe the sequence of research findings that...Ch. 12 - Describe the molecular composition and arrangement...Ch. 12 - Describe the transitions that occur as nucleosomes...Ch. 12 - Provide a comprehensive definition of...Ch. 12 - Mammals contain a diploid genome consisting of at...Ch. 12 - Assume that a viral DNA molecule is a 50-m-long...Ch. 12 - How many base pairs are in a molecule of phage T2...Ch. 12 - Examples of histone modifications are acetylation...Ch. 12 - Contrast the structure of SINE and LINE DNA...Ch. 12 - Variable number tandem repeats (VNTRs) are...Ch. 12 - It has been shown that infectious agents such as...Ch. 12 - Cancer can be defined as an abnormal proliferation...Ch. 12 - In a study of Drosophila, two normally active...Ch. 12 - Prob. 21ESPCh. 12 - An article entitled Nucleosome Positioning at the...Ch. 12 - Prob. 23ESPCh. 12 - Following is a diagram of the general structure of...Ch. 12 - Microsatellites are currently exploited as markers...Ch. 12 - At the end of the short arm of human chromosome 16...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If the recipient cell did not already have a lys− gene, could the lys+ DNA become incorporated into the bacterial chromosome? Explain.arrow_forwardFigure 1 is a photography obtained after spreading the replicating Escherichia coli chromosome and its observation by transmission electron microscopy. An interpretation scheme of the observed structure is shown in the upper right part of the photo. Figure 1: Photography of a replicating Escherichia coli chromosome observed by transmission electron microscopy. what is occurring at the positions C indicated by black arrows? what is the name of the main actor located at positions C?arrow_forwardThe beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACCATTATАССССТАСGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?arrow_forward
- The following nucleotide sequence is found on the template strand of DNA. First, determine the amino acids of the protein encoded by this sequence by using the genetic code provided in Figure 15.10. Then give the altered amino acid sequence of the protein that will be found in the following mutations: Q.Mutant 4: A T S A transversion at nucleotide 15arrow_forwardDetermine the order of the three genes on the phage chromosome.arrow_forward#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:arrow_forward
- The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACСАТТАТАССССТАСGTGATAG...5" promoter a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'arrow_forwardRefer to Figure , which describes the base modifications of bacteriophage T4 DNA, and briefly describe some issues that must be dealt with in preparing a restriction map of T4 DNA.arrow_forwardYou are analyzing the intracellular DNA intermediates formed during the replication of the single-stranded (ss) DNA phage M13. In a replication mutant, you find accumulation of DNA molecules with the following properties:Results of a 0.7% agarose gel electrophoresis run at pH 8.0 – gel is running top tobottom, with the origin at the top of the diagram. The smudges indicate several bandswith slightly different migration rates. open circle M13closed circle M13 Left lane — markers (wild-type open circle M13 and closed circle M13)2nd lane — DNA extracted from mutant M13 phage cells3rd lane — DNA extracted from mutant M13 phage cells denatured4th lane — DNA extracted from normal M13 phage cellsRight lane — DNA extracted from normal M13 phage cells denaturedProfiles from a 5 – 20% sucrose gradient centrifuging of the mutant M13 phage DNA The arrow on the neutral (pH 7.4) gradient shows the position of the covalently closed circular DNA. On the alkaline (pH 12.5) gradient, note two peaks…arrow_forward
- The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'.TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'.AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. d Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 -41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?arrow_forwardNutri Valeur n valories/Caleortes 370 Lipidas 75 9 rans 6 m Bodiores 200 mg Pause Alt Gr Ctri elestérel 0 mg ides 10 g 3% S The microtubules of the spindle apparatus attach to a specialized region of the centromere of each chromosome called the: A) kinetochore B) nucleosome ucieotide D) equatorial plate C) tetrad Use the followina information to answer the next question. A diet rich in lycopene, a nutrient found in tomatoes, can reduce the risk of cancer by preventing genetic damage and abnormal cell growth in regular body cells. Lycopene has been shown to reduce the size of tumours and slow the spread of the cancerous tissue. 6. Lycopene slows the spread of cancerous growth by decreasing the rate of Mitosis, which produces diploid cells Mitesis, which produces haploid cells a. Meiosis, which produces diploid cells d. Meiosis, which produces haploid cells C. 7. What is the phase of mitosis demonstrated in the photograph below? Doc. RND.. Josef Reischig, CSc. - Author's archive, CC…arrow_forwardwhen various strains of lambda phage are seeded on a lawn of e.coli, they can form clear or turbid plaques. Explain the difference between the two types of plaques. can all bacteriophage form clear and turbid plaques?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY