BIOLOGY:LIFE ON EARTH-W/ACCESS
11th Edition
ISBN: 9780134669076
Author: Audesirk
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 2AC
Summary Introduction
To review:
The double helical structure of deoxyribonucleic acid (DNA). Sequence encoded on one strand of a double helix encodes useful information on the other strand or not.
Introduction:
DNA is composed of repeated units of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
DNA exists in cells as a double-stranded duplex molecule, whereas RNA, which is composed of very similar nucleotides linked together in the same way, does not form a doublestranded duplex in cells. Why not? If you were to place complementary single-strands of RNA in a test tube, would they spontaneously form duplex molecules?
the human immunodeficiency virus HIV uses RNA rather than DNA to encode genetic information. During infection, however, HIV uses an enzyme known as reverse transcriptase to generate double-stranded DNA. Generally speaking, how would the enzyme generate a double strand of DNA from a single strand of RNA?
Which complementary base pair, G-C or A-T, would be hardest to break apart when a double-strandedDNA helix unwinds during cellular processes?
Chapter 12 Solutions
BIOLOGY:LIFE ON EARTH-W/ACCESS
Ch. 12 - 1. If a parental DNA strand has the base sequence...Ch. 12 - 2. What happens at the conclusion of DNA...Ch. 12 - An insertion mutation occurs when a nucleotide is...Ch. 12 - The rungs of the DNA double helix consist of any...Ch. 12 - The “rungs” of the DNA double helix are held...Ch. 12 - 1. DNA consists of subunits called_________. Each...Ch. 12 - The subunits of DNA are assembled by linking...Ch. 12 - The “base pairing rule” in DNA is that adenine...Ch. 12 - 4. When DNA is replicated, two new DNA double...Ch. 12 - The DNA double helix is unwound by an enzyme...
Ch. 12 - 6. Sometimes mistakes are made during DNA...Ch. 12 - Describe the experimental evidence that DNA is the...Ch. 12 - 2. Draw the general structure of a nucleotide....Ch. 12 - Describe the structure of DNA. Where are the...Ch. 12 - How is information encoded in the DNA molecule?Ch. 12 - 5. Describe the process of DNA replication.
Ch. 12 - How do mutations occur? Describe the principal...Ch. 12 - 1. In an alternate universe, although proteins are...Ch. 12 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA that is transcribed from this gene is: 5'AUGUAUGGUUGACUCCUAGCG3' Which strand of the DNA - top or bottom - is the template strand? Explain how you know.arrow_forwardWhy do you think it is important that the sugar-phosphate backbone of DNA be held together by covalent bonds while the two strands of double stranded DNA are held together by hydrogen bonds?arrow_forwardThe compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with keto groups (== O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix has the following sequence: TTGGATGCTGG AACCTACGACC A. What would be the sequence of this double helix immediately after reaction with nitrous acid? Let the letter H represent hypoxanthine and U represent uracil. B. Let’s suppose this DNA was treated with nitrous acid. The nitrous acid was then removed, and the DNA was replicated for two generations. What would be the sequences of the DNA products after the DNA had replicated twice? Your answer should contain the sequences of four double helices. Note: During DNA replication, uracil hydrogen bonds with adenine, and hypoxanthine hydrogen bonds with cytosine.arrow_forward
- why can we not describe the “average” behavior of a DNA molecule? Why is it improbable that proteins needed for DNA structure, for example, form spontaneously from random amino acids?arrow_forwardThe template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?arrow_forwardDo any strands of nucleic acid exist in nature in which part of the strand is DNA and another part of that same strand is RNA? If so, describe when such strands of nucleic acid are synthesized. Is the RNA component at the 5′ end or at the 3′ end?arrow_forward
- The following diagram of a generalized tetranucleotide will serve as a basis for the three questions marked “a” through “c.” (02) (a) Is this a DNA or an RNA molecule? State which _________ (b) Place an “X” (in one of the circles provided) at the 3' end of this tetranucleotide. (c) Given that the DNA strand, which served as a template for the synthesis of this tetranucleotide, was composed of the bases 5'- A C A G - 3', fill in the parentheses (in the diagram) with the expected basesarrow_forwardDo any strands of nucleic acid exist in nature in which part of the strand is DNA and part is RNA? If so, a.describe when such strands of nucleic acid are synthesized. Is the RNA component at the 5' end or at the 3' end?arrow_forwardWhy do you think all organisms use nucleic acids for encoding genetic information? Why not use proteins or carbohydrates? What advantages might DNA have as the source of genetic information?arrow_forward
- Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'arrow_forwardIf a DNA double helix that is 100 base pairs in length has32 adenines, how many cytosines, guanines, and thymines must it have?arrow_forwardSome proteins such as DNA ligase can temporarily bind to DNA. If such a protein interacts with the sugar-phosphate backbone of DNA, would you expect hydrogen bonding between the protein and the DNA to be involved? Why or why not?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license