ESSENTIALS OF GENETICS-W/MOD.ACCESS
9th Edition
ISBN: 9780134452876
Author: KLUG
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 12, Problem 6PDQ
Summary Introduction
To review:
The coding experiments were done by using repeating
Introduction:
Triplet codons are degenerate. It means more than one amino acid can be specified by more than one triplet codons. Wobble hypothesis was postulated by Crick in 1966. This hypothesis was used to predict that the initial two nucleotides of the codon are more critical as compared to the third
Given:
AGG codes for arginine.
The table below shows the data of coding experiments carried out by using repeating copolymers.
Copolymer | Codon produced | Amino acids in a polypeptide |
AG | AGA, GAG | arg (arginine), glu (glutamine) |
AAG | AGA, AAG, GAA | Lys ( lysine), arg, glu |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
In a coding experiment using repeating copolymers , the following data were obtained: Copolymer Codons Produced Amino Acids in Polypeptide AG AGA, GAG Arg, Glu AAG AGA, AAG, GAA Lys, Arg, Glu AGG is known to code for arginine. Taking into account the wobble hypothesis, assign each of the four codons produced in the experiment to its correct amino acid.
The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and Lys, respectively. Can you think of a reason why polyG was not used as a translation template in these experiments?
You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly.
Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?. If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located?
Chapter 12 Solutions
ESSENTIALS OF GENETICS-W/MOD.ACCESS
Ch. 12 - CASE STUDY | A drug that sometimes works A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 12 - Review the Chapter Concepts list on p. 215. These...Ch. 12 - In studies of frameshift mutations, Crick,...Ch. 12 -
4. The mRNA formed from the repeating...Ch. 12 - In studies using repeating copolymers, AC......Ch. 12 - Prob. 6PDQCh. 12 - Prob. 7PDQ
Ch. 12 -
8. When the amino acid sequences of insulin...Ch. 12 - Prob. 9PDQCh. 12 - Why doesn't polynucleotide phosphorylase (Ochoa's...Ch. 12 - Refer to Table 12.1. Can you hypothesize why a...Ch. 12 -
12. Predict the amino acid sequence produced...Ch. 12 - A short RNA molecule was isolated that...Ch. 12 - A glycine residue exists at position 210 of the...Ch. 12 - Shown here is a theoretical viral mRNA sequence...Ch. 12 -
16. Most proteins have more leucine than...Ch. 12 - Define the process of transcription. Where does...Ch. 12 - Describe the structure of RNA polymerase in...Ch. 12 - In a written paragraph, describe the abbreviated...Ch. 12 - Messenger RNA molecules are very difficult to...Ch. 12 - One form of posttranscriptional modification of...Ch. 12 - In a mixed copolymer experiment, messages were...Ch. 12 -
23. Shown in this problem are the amino acid...Ch. 12 - Alternative splicing is a common mechanism for...Ch. 12 - The genetic code is degenerate. Amino acids are...
Knowledge Booster
Similar questions
- You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?arrow_forwardConsider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant ....CTTGCTAGCGAATC....The substitution shown seems to have created a stop codon. What further information do you need to be confident that it has done so?arrow_forwardConsider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?arrow_forward
- A glycine residue is in position 210 of the tryptophan synthetase enzyme of wild-type E. coli. If the codon specifying glycine is GGA, how many single-base substitutions will result in an amino acid substitution at position 210? What are they? How many will result if the wild-type codon is GGU?arrow_forwardIn 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter? (More than one may apply). A. Synthetic mRNA B. DNA C. Anti-codons D. Radioactive amino acids E. Large ribosomal subunits F. Small ribosomal subunitsarrow_forwardConsider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGAarrow_forward
- What would be the phenotype of an E. coli strain in which the tandem tryptophan codons in the leader region were mutated so that they coded for serine instead?arrow_forwardTwo missense mutations in the gene that encodes an enzyme called superoxide dismutase cause a form of amyotrophic lateral sclerosis (ALS, or Lou Gehrig disease). This disease causes loss of neurological function over a 5-year period. One mutation alters the amino acid asparagine (Asn) to lysine (Lys). The other changes an isoleucine (Ile) to a threonine (Thr). List the codons involved and describe how single-base mutations can alter the specified amino acids.arrow_forwardA normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?arrow_forward
- According to wobble rules, what codons should be recognized by the following anticodons? What amino acid residues do these correspond to?(a) 5′ ¬ICC ¬ 3′ (b) 5′ ¬GCU ¬3′arrow_forwardWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forwardWhat are the amino acid coded for each of these codons? 1. UUA 2. AUU 3. UGU 4. AAA 5. GAG 6. UAAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning