Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 8P
Interpretation Introduction
Interpretation:
The
Concept introduction:
The technique that is used to amplify the fragments of the DNA template to form particular fragments of DNA in vitro is known as the polymerase chain reaction (PCR).
The restriction enzymes are also called as restriction endonucleases. The restriction endonucleases are used for the hydrolysis of the phosphodiester backbone present on the particular DNA sequence.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionKnowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. CRISPR/Cas9: Design of a gRNA to Target the Human PVALB Gene The human PVALB gene, which encodes the Ca2+-binding protein parvalbumin, can be Targeted by CRISPR/Cas9, at the protospacer sequence - ATGCAGGAGGGTGGCGAGAGGGGCCGAGAT- followed by a -TGG-PAM trinucleotide. Give the sequence of the spacer region of a gRNA that will target the complementary DNA strand at this site. Include at the 3'-end of your gRNA sequence a region that will form a stem-loop structure with a 5'-AGCAUAGCUGUAAAAC- sequence downstream in the gRNA to create the dsRNA-binding site for Cas9.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Sequence Relationship Between an Antisense RNA Strand and Its Template DNA Strand The DNA strand that is complementary to the template strand copied by RNA polymerase during transcription has a nucleotide sequence identical to that of the RNA being synthesized (except T residues are found in the DNA strand at sites where U residues occur in the RNA). An RNA transcribed from this nontem-plate DNA strand would be complementary to the mRNA synthesized by RNA polymerase. Such an RNA is called antisense RNA because its base sequence is complementary to the “sense mRNA. One strategy to thwart the deleterious effects of genes activated in disease slates (such as cancer) is to generate antisense RNAs in affected cells. These antisense RNAs would form double-stranded hybrids with mRNAs transcribed from the activated genes and prevent their translation into protein. Suppose transcription of a cancer-activated gene yielded an mRNA whose sequence included the segment 5’-UACGUCUAAGCUGA. What is the corresponding nucleotide sequence (5’ The template strand in a DNA duplex that might be introduced into these cells so that an untisense RNA could be transcribed from it?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Supercoiling Parameters Suppose one double helical turn of a superhelical DNA molecule changes conformation from B- to Z-form. What are the changes in L, W, and T? Why do you suppose the transition of DNA from B- to Z-form is favored by negative supercoiling?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B-and Z-DNA Helical Parameters II If 80% of the base pairs in a duplex DNA molecule (12.5 kbp) are in the B-conformation and 20% are in the Z-conformation, what is the length of the molecule?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Structural complementarity is the key to molecular recognition, a lesson learned in Chapter 1. The principle of structural complementarity is relevant to answering problems 5, 6, 7,11, 12, and 19. The quintessential example of structural complementarity in all of biology is the DNA double helix. What features of the DNA double helix exemplify structural complementarity?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Evaluation of -Helices in Proteins The hem agglutinin protein in influenza virus contains a remarkably long -helix, with 53 residues. How long is this -helix (in nm)? How many turns does this helix have? The typical residue in an -helix is involved in two H bonds. How many H bonds are present in this helix?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. (Research Problem) The Nature and Roles of Linear Motifs in Proteins In addition to domains and modules, there are other significant sequence patterns in proteins—known as linear motifs—that are associated with a particular function. Consult the biochemical literature to answer the following questions: 1. What are linear motifs? 2. How are they different from domains?. 3. What are their functions? 4. How can they be characterized? 5. There are several papers that are good starting points for this problem. Neduva, V., and Russell, R., 2005. Linear motifs: evolutionary interaction switches. FEBS Letters 579:3342-3345. Gibson, T., 2009. Cell regulation: determined to signal discrete cooperation. Trends in Biochemical Sciences 34:471-482. Diella, K. Haslam, N., Chica., C. et aL, 2009. Understanding eukaryotic linear motifs and their role in cell signaling and regulation. Frontiers of Bioscience 13:6580-6603.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Identify Proteins Using BLAST Searches of Peptide Fragment Sequences Go to the National Center for Biotechnology Information Web site at httlp:llhwww.ncbi.nlm.niih.goyl. From the menu (if Popular Resources on the right-hand side, click on “BLAST. Under the Basic BLAST heading on the new page that comes up, dick on protein blast. lit the Enter Query Sequence box at the top of the page that comes up, enter the following sequence: NQMMK.SR.N- LTKDRCKP. Confirm that the database under ChoOsC Search Set us set (111 nr (nonredundant protein Sequences), then click the BLAST button at the bottom (if the page td see the results of your search. Next, enter this sequence from a different protein: SLQTASAPDVYAlGfcCA. Identify the protein from which this sequence was derived.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Consider the following peptide sequences: EANQIDEMLYNVQCS LTTLE DTVPW LG VHLDITVPL SWTWTLYVKL QQNWGGLWILTLVWFLM CNMKHGDSQCDERTYP YTREQSDGHIPKMNCDS AGPFGPDGPTIGPK Which of the preceding sequences would be likely to be found in each of the following: A parallel -sheet An antiparallel -sheet A tropocollagen molecule The helical portions of a protein found in your hairarrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY