Case Manipulator Program plan: Include the required header files to the program. Declare the constant variable. Declare function prototypes which are used in the program. Define the “main()” function. Declare the required variables. Get the input C-string from the user. Copy the string 1 to string 2 and string 3. Call the “upper ()” function and display the result. Call the “lower ()” function and display the result. Call the “flip ()” function and display the result. Define the “upper ()” function. Check the string not equal to zero. If the letter is not an uppercase, change the letters into uppercase using “toupper” function. Define the “lower ()” function. Check the string not equal to zero. If the letter is not a lowercase, change the letters into lowercase using “tolower” function. Define the “flip ()” function. Check the string not equal to zero. If the letter is not an uppercase, change the letters into uppercase using “toupper” function. Otherwise, if the letter is not a lowercase, change the letters into lowercase using “tolower” function.

Question

Want to see the full answer?

Answer 1

Question

Chapter 12, Problem 9PC

Program Plan Intro

Case Manipulator

Program plan:

Include the required header files to the program.

Declare the constant variable.

Declare function prototypes which are used in the program.

Define the “main()” function.

Declare the required variables.

Get the input C-string from the user.

Copy the string 1 to string 2 and string 3.

Call the “upper ()” function and display the result.

Call the “lower ()” function and display the result.

Call the “flip ()” function and display the result.

Define the “upper ()” function.

Check the string not equal to zero.

If the letter is not an uppercase, change the letters into uppercase using “toupper” function.

Define the “lower ()” function.

Check the string not equal to zero.

If the letter is not a lowercase, change the letters into lowercase using “tolower” function.

Define the “flip ()” function.

Check the string not equal to zero.

If the letter is not an uppercase, change the letters into uppercase using “toupper” function.

Otherwise, if the letter is not a lowercase, change the letters into lowercase using “tolower” function.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

C++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…

String Manipulation In this question, you will be implementing the following functions int findChar(char * str, char c); Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1 int replaceChar(char * str, char c1, char c2); Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0. int removeChar(char * str1, char * str2, char c); Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’ For example, if str1=”Hello World” and c=’l’ then the function should make str2=”He**o Wor*d” int isPalindrome(char * str) Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc. int reverseString(char…

Write a function findLetter based on the following rules: It takes a string named str and a character named ch as parameter, returns the index of the first occurrence of the character ch if the str string contains the character ch; If the relevant character is not found in the string, write a function that returns -1. Call the function inside the main function and test it. You should use the prototype given below: int findLetter (char str [], char ch)