Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12.5, Problem 1CS
Core Skill: Connections Look back at Figure 6.3, which describes the hydrolysis of ATP. Why is ATP needed to charge a tRNA?
Figure 6.3 The hydrolysis of ATP to ADP and Pi. As shown in this figure, ATP has a net charge of −4, while ADP and Pi are shown with net charges of −2 each. When these compounds are shown in
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Q. In protein structure modelling, how you identify the best model? Name and explain the parameters you take into consideration while selecting a model. ( Subject: Bioinformatics)
Topic: Enzyme (Prelab)
Define optimum pH and temperature of an enzyme
How do changes in pH and temperature affect the native conformation of an enzyme?
The lab you joined recently want to investigate the role of uncoupling protein in-vivo models. Your supervisor knew that you have learnt in-vivo model and uncoupling in your BIOTECH 2CB3 course. Based on the information you learnt you have to make a list of organisms that could be used kind to study the mechanism of uncoupling of proteins? What are you are going tp suggest as an ideal model to study the uncoupling proteins in-vivo?
only one answer options:
newborn mammals, hibernating animals
animals acclimated to cold environments
animals live in hot weather
I and II
I and III
Chapter 12 Solutions
Biology
Ch. 12.1 - What disease would result if a person inherited...Ch. 12.1 - Prob. 2CCCh. 12.1 - What is the direction of flow of genetic...Ch. 12.2 - Core Skill: Connections Look back at the role of...Ch. 12.3 - Prob. 1CCCh. 12.4 - Prob. 1CCCh. 12.4 - Prob. 1EQCh. 12.4 - Prob. 2EQCh. 12.4 - Prob. 3EQCh. 12.5 - Core Skill: Connections Look back at Figure 6.3,...
Ch. 12.5 - Prob. 2CSCh. 12.6 - Prob. 1CCCh. 12 - Which of the following best represents the central...Ch. 12 - A mutation prevents a gene from being transcribed...Ch. 12 - Prob. 3TYCh. 12 - Prob. 4TYCh. 12 - If a eukaryotic mRNA failed to have a cap attached...Ch. 12 - Prob. 6TYCh. 12 - Prob. 7TYCh. 12 - During the initiation of translation, the first...Ch. 12 - Prob. 9TYCh. 12 - Prob. 10TYCh. 12 - Prob. 1CQCh. 12 - Prob. 2CQCh. 12 - Prob. 3CQCh. 12 - Prob. 1COQCh. 12 - Prob. 2COQ
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some species of bacteria that live at the surface of sediment on the bottom of lakes are capable of using eithe...
Biology: Life on Earth with Physiology (11th Edition)
Identify me theme or themes exemplified by (a) the sharp quills of a porcupine (b) the development of a multice...
Campbell Biology in Focus
Describe the role and impact of microbes on the earth.
Microbiology Fundamentals: A Clinical Approach - Standalone book
What are the cervical and lumbar enlargements?
Principles of Anatomy and Physiology
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNAtranscript and use the genetic code to determine the resulting amino acid sequence. Note that the givenstrands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end withstop codon.1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________arrow_forwardBIO168 Human Anatomy & Physiology I Practice Worksheet B Sequence of muscle contraction Number the following statements in their proper sequence to describe the contraction mechanism in a skeletal muscle cell. _____ A. Acetylcholine is released into the neuromuscular junction by the axonal terminal. _____ B. The action potential, carried deep into the cell, causes the sarcoplasmic reticulum to release calcium ions. ____ C. The muscle cell relaxes and lengthens. _____ D. Acetylcholine diffuses across the neuromuscular junction and binds to receptors on the sarcolemma. ____ E. The calcium ion concentration at the myofilaments increases; the myofilaments slide past one another, and the cell shortens. _____ F. Depolarization occurs, and the action potential is generated. _____ G. As calcium is actively reabsorbed into the sarcoplasmic reticulum, its concentration at the myofilaments decreases.arrow_forwardPractice drawing the structures of adenine, adenosine, and adenylate.arrow_forward
- pls help ASAP, thank you! “which feature of protein folding is NOT accurate?”arrow_forwardVISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.arrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:arrow_forward
- Need help. Plz explain briefly Describe in detail with the aid of diagrams the use of chemical shift perturbation mapping to identify ligand binding sites on a protein.arrow_forwardVISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.arrow_forwardLearning Objectives Identify a peptide bond, the N-terminus (amino-terminus) and C- terminus (carboxyl-terminus) of a polypeptide in a series of linked amino acids. Describe the four levels of protein structure (primary, secondary, tertiary, and quaternary), what types of bonding interactions hold each level together, and how a protein’s structure relates to its cellular function. Link the chemical structures of amino acid R groups to the types of interactions they could form in the folded structure of a protein. Hypothesize the likely consequence of environmental conditions on the folded structure. Recognize secondary structure elements when proteins are represented in different ways (e.g. ball-and-stick structures, ribbon diagrams). Define these terms: enzyme, enzyme activity, active site, substrate, enzyme substrate complex, product, denature. Explain with molecular detail how some conditions affect enzyme activity.arrow_forward
- Go to BIOMAN Enzyme Activity 1. What does the enzyme bind to in order to carry out its reaction? 2. Where on the enzyme does the reactant bind? 3. Can all three enzymes be used to carry out the same reaction?arrow_forwardQ1. What is Tg and Tm. Compare them in terms of polymeric chain motion. (in 2 pages)arrow_forwardPractice HW make a nucleotide sequence (Template strand and Coding strand) of at least 15 base pairs for each of these steps to show your understanding of how genetic information is stored and used within a cell make sure that there are start and stop positions and note the direction of the sequence--- 5’ to 3’ or 3’ to 5.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY