The start codon and the amino acids sequences translated from mRNA sequence 5'- GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3'. Introduction: Codons are the three nucleotide sequences of either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), which correspond to particular stop signals or amino acids at the time of protein synthesis. The full set of codons are known as the genetic code.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 13, Problem 1CONQ

Summary Introduction

To review:

The start codon and the amino acids sequences translated from mRNA sequence 5'- GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3'.

Introduction:

Codons are the three nucleotide sequences of either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), which correspond to particular stop signals or amino acids at the time of protein synthesis. The full set of codons are known as the genetic code.

Expert Solution & Answer

Explanation of Solution

The start codon is the AUG acts as a signal codon, which helps in the initiation of translation. It is the first codon of messenger RNA. It is present in both eukaryotes and prokaryotes. In eukaryotes, it starts from 5'untranslated region. However, in prokaryotes it includes ribosomal binding sites.

The codon which is known as start codon is AUG, which codes for methionine. There are some codons which are known as stop codons, which terminate the translation of amino acids. The stop codons are UAA, UAG, and UGA. The amino acids, which will be obtained from given mRNA sequences are mentioned below:-

Genetics, Chapter 13, Problem 1CONQ

Conclusion

Therefore, it can be concluded that the codon which starts from 5^th nucleotide is AUG. The amino acid sequences are Met, Gly, Asn, Lys, Pro, Gly, Gln, and STOP.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.

An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.

An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.

Answer 2

Question

Chapter 13, Problem 1CONQ

Summary Introduction

To review:

The start codon and the amino acids sequences translated from mRNA sequence 5'- GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3'.

Introduction:

Codons are the three nucleotide sequences of either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), which correspond to particular stop signals or amino acids at the time of protein synthesis. The full set of codons are known as the genetic code.

Expert Solution & Answer

Explanation of Solution

The start codon is the AUG acts as a signal codon, which helps in the initiation of translation. It is the first codon of messenger RNA. It is present in both eukaryotes and prokaryotes. In eukaryotes, it starts from 5'untranslated region. However, in prokaryotes it includes ribosomal binding sites.

The codon which is known as start codon is AUG, which codes for methionine. There are some codons which are known as stop codons, which terminate the translation of amino acids. The stop codons are UAA, UAG, and UGA. The amino acids, which will be obtained from given mRNA sequences are mentioned below:-

Genetics, Chapter 13, Problem 1CONQ

Conclusion

Therefore, it can be concluded that the codon which starts from 5^th nucleotide is AUG. The amino acid sequences are Met, Gly, Asn, Lys, Pro, Gly, Gln, and STOP.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 13, Problem 1CONQ

Summary Introduction

To review:

The start codon and the amino acids sequences translated from mRNA sequence 5'- GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3'.

Introduction:

Codons are the three nucleotide sequences of either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), which correspond to particular stop signals or amino acids at the time of protein synthesis. The full set of codons are known as the genetic code.

Expert Solution & Answer

Explanation of Solution

The start codon is the AUG acts as a signal codon, which helps in the initiation of translation. It is the first codon of messenger RNA. It is present in both eukaryotes and prokaryotes. In eukaryotes, it starts from 5'untranslated region. However, in prokaryotes it includes ribosomal binding sites.

The codon which is known as start codon is AUG, which codes for methionine. There are some codons which are known as stop codons, which terminate the translation of amino acids. The stop codons are UAA, UAG, and UGA. The amino acids, which will be obtained from given mRNA sequences are mentioned below:-

Genetics, Chapter 13, Problem 1CONQ

Conclusion

Therefore, it can be concluded that the codon which starts from 5^th nucleotide is AUG. The amino acid sequences are Met, Gly, Asn, Lys, Pro, Gly, Gln, and STOP.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 13, Problem 1CONQ

Summary Introduction

To review:

The start codon and the amino acids sequences translated from mRNA sequence 5'- GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3'.

Introduction:

Codons are the three nucleotide sequences of either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), which correspond to particular stop signals or amino acids at the time of protein synthesis. The full set of codons are known as the genetic code.

Expert Solution & Answer

Explanation of Solution

The start codon is the AUG acts as a signal codon, which helps in the initiation of translation. It is the first codon of messenger RNA. It is present in both eukaryotes and prokaryotes. In eukaryotes, it starts from 5'untranslated region. However, in prokaryotes it includes ribosomal binding sites.

The codon which is known as start codon is AUG, which codes for methionine. There are some codons which are known as stop codons, which terminate the translation of amino acids. The stop codons are UAA, UAG, and UGA. The amino acids, which will be obtained from given mRNA sequences are mentioned below:-

Genetics, Chapter 13, Problem 1CONQ

Conclusion

Therefore, it can be concluded that the codon which starts from 5^th nucleotide is AUG. The amino acid sequences are Met, Gly, Asn, Lys, Pro, Gly, Gln, and STOP.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 13, Problem 1CONQ

Summary Introduction

To review:

The start codon and the amino acids sequences translated from mRNA sequence 5'- GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3'.

Introduction:

Codons are the three nucleotide sequences of either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), which correspond to particular stop signals or amino acids at the time of protein synthesis. The full set of codons are known as the genetic code.

Expert Solution & Answer

Explanation of Solution

The start codon is the AUG acts as a signal codon, which helps in the initiation of translation. It is the first codon of messenger RNA. It is present in both eukaryotes and prokaryotes. In eukaryotes, it starts from 5'untranslated region. However, in prokaryotes it includes ribosomal binding sites.

The codon which is known as start codon is AUG, which codes for methionine. There are some codons which are known as stop codons, which terminate the translation of amino acids. The stop codons are UAA, UAG, and UGA. The amino acids, which will be obtained from given mRNA sequences are mentioned below:-

Genetics, Chapter 13, Problem 1CONQ

Conclusion

Therefore, it can be concluded that the codon which starts from 5^th nucleotide is AUG. The amino acid sequences are Met, Gly, Asn, Lys, Pro, Gly, Gln, and STOP.

Answer 6

Chapter 13, Problem 1CONQ

Summary Introduction

To review:

The start codon and the amino acids sequences translated from mRNA sequence 5'- GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3'.

Introduction:

Codons are the three nucleotide sequences of either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), which correspond to particular stop signals or amino acids at the time of protein synthesis. The full set of codons are known as the genetic code.

Expert Solution & Answer

Explanation of Solution

The start codon is the AUG acts as a signal codon, which helps in the initiation of translation. It is the first codon of messenger RNA. It is present in both eukaryotes and prokaryotes. In eukaryotes, it starts from 5'untranslated region. However, in prokaryotes it includes ribosomal binding sites.

The codon which is known as start codon is AUG, which codes for methionine. There are some codons which are known as stop codons, which terminate the translation of amino acids. The stop codons are UAA, UAG, and UGA. The amino acids, which will be obtained from given mRNA sequences are mentioned below:-

Genetics, Chapter 13, Problem 1CONQ

Conclusion

Therefore, it can be concluded that the codon which starts from 5^th nucleotide is AUG. The amino acid sequences are Met, Gly, Asn, Lys, Pro, Gly, Gln, and STOP.

Answer 7

Chapter 13, Problem 1CONQ

Summary Introduction

To review:

The start codon and the amino acids sequences translated from mRNA sequence 5'- GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3'.

Introduction:

Codons are the three nucleotide sequences of either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), which correspond to particular stop signals or amino acids at the time of protein synthesis. The full set of codons are known as the genetic code.

Answer 8

Expert Solution & Answer

Explanation of Solution

The start codon is the AUG acts as a signal codon, which helps in the initiation of translation. It is the first codon of messenger RNA. It is present in both eukaryotes and prokaryotes. In eukaryotes, it starts from 5'untranslated region. However, in prokaryotes it includes ribosomal binding sites.

The codon which is known as start codon is AUG, which codes for methionine. There are some codons which are known as stop codons, which terminate the translation of amino acids. The stop codons are UAA, UAG, and UGA. The amino acids, which will be obtained from given mRNA sequences are mentioned below:-

Genetics, Chapter 13, Problem 1CONQ

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Conclusion

Therefore, it can be concluded that the codon which starts from 5^th nucleotide is AUG. The amino acid sequences are Met, Gly, Asn, Lys, Pro, Gly, Gln, and STOP.

Answer 12

Ch. 13.1 - Prob. 1COMQ Ch. 13.1 - 2. The reason why Beadle and Tatum observed four...Ch. 13.2 - What is the genetic code? a. The relationship...Ch. 13.2 - Prob. 2COMQ Ch. 13.2 - The fourth codon in an mRNA sequence is GGG, which...Ch. 13.2 - Prob. 4COMQ Ch. 13.3 - Prob. 2COMQ Ch. 13.4 - Prob. 1COMQ Ch. 13.4 - 2. The anticodon of a tRNA is located in the a....Ch. 13.4 - An enzyme known as _______attaches an amino acid...

Concept explainers

Videos

Explanation of Solution

Want to see more full solutions like this?

Chapter 13 Solutions