ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13, Problem 54P
In the accompanying figure, the top and bottom lines represent regions of chromosomes 4 and 12 in the yeast Saccharomyces cerevisiae (Scer 4 and Scer 12). Numbers refer to specific genes, and the red arrows represent the direction and extent of transcription. The middle line is the sequence of a region from chromosome 1 of a different, but related yeast species called Klyuyveromyces waltii (Kwal 1), with genes indicated in light blue. Similarities in DNA sequence are shown as lines joining chromosomes of the two species.
a. | What is the meaning of the two K. waltii genes filled in dark purple? |
b. | Based on these data, formulate a hypothesis to explain the genesis of the part of the S. cerevisiae genome illustrated in the figure. |
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
In yeast, LYS5, ADE1, and URA2 are genes required to synthesize lysine,
adenine and uracil, respectively. A MATa lys5 ADE1 URA2 haploid was mated
to a MATA LYS5 ade1 ura2 haploid to make a triply heterozygous diploid. This
diploid was put through meiosis, 100 tetrads were dissected and the spore
colonies transferred to medium lacking either lysine, adenine or uracil to
determine which spores were prototrophic or auxotrophic for those nutrients.
The following results were obtained:
LYS5-ADE1
ADE1-URA2
LYS5-URA2
PD
NPD
Ι
20
22
58
18
20
62
50
8
42
Based on this information, select the statements below that are TRUE.
Select 4 correct answer(s)
A) The LYS5 and URA2 genes are linked.
B)
The genotypes of the four spores in the ADE1-URA2 tetratypes is
ade1 ura2
ade1 URA2
ADE1 ura2
ADE1 URA2
C) The map distance between ADE1 and URA2 is 51 CM.
D) ADE1 and URA2 are likely located on the same chromosome.
E) The map distance between LYS5 and URA2 is 29 CM.
☐ F) LYS5 and ADE1 independently assort…
Discuss how ultra violet light works as a mutagen. This could include:
What is UV light and the Mutations commonly introduced by UV light? What are the Repair mechanisms in yeast that fix damage caused by UV light?
Describe the phenotypes of Saccharomyces Cerevisiae plates, the first plate is the control yeast, while the second plate has been exposed to low UV light, the third plate has been exposed to high UV light. Normal yeast has round smooth white colonies. Are there any signinifcant differences?
For a haploid fungus, the starting point in the biosynthesis of the amino acid
arginine is Compound X, which is always present in and absorbed from the
environment. The arginine biosynthetic pathway is:
Enzyme A
Enzyme B
Enzyme Ç
Compound X
It is know that genes encoding enzymes A and C are on two different
chromosomes.
Compound Y
Compound Z-
Arginine
A mutant strain of genotype a (lacking only enzyme A) is crossed to a mutant strain
of genotype c (lacking only enzyme C) to generate a diploid strain. Sporulation (i.e.
meiosis) is subsequently induced in the resulting diploid strain. What proportion of
the spores (haploids formed by sporulation) is expected to grow on medium without
arginine but supplemented with Compound Y?
O 100%
50%
0%
25%
Chapter 13 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 13 - For each of the terms in the left column, choose...Ch. 13 - Prob. 2PCh. 13 - For each of the following types of chromosomal...Ch. 13 - For the following types of chromosomal...Ch. 13 - One of the X chromosomes in a particular...Ch. 13 - A diploid strain of yeast was made by mating a...Ch. 13 - The two graphs that follow represent genomic...Ch. 13 - A series of chromosomal mutations in Drosophila...Ch. 13 - Indicate which of the four major classes of...Ch. 13 - The recessive, X-linked z1 mutation of the...
Ch. 13 - Genes a and b are 21 m.u. apart when mapped in...Ch. 13 - In the following group of figures, the pink lines...Ch. 13 - Three strains of Drosophila Bravo, X-ray, and...Ch. 13 - Two yeast strains were mated and sporulated...Ch. 13 - Suppose a haploid yeast strain carrying two...Ch. 13 - In the mating between two haploid yeast strains...Ch. 13 - During ascus formation in Neurospora, any...Ch. 13 - In the following figure, black and pink lines...Ch. 13 - In Drosophila, the gene for cinnabar eye color is...Ch. 13 - Semisterility in corn, as seen by unfilled ears...Ch. 13 - A promising biological method for insect control...Ch. 13 - Prob. 23PCh. 13 - a. Among the progeny of a self-fertilized...Ch. 13 - Duchenne muscular dystrophy DMD is caused by a...Ch. 13 - WHIM syndrome is a disease of the immune system...Ch. 13 - Explain how transposable elements can cause the...Ch. 13 - The Drosophila genome normally harbors about 40 P...Ch. 13 - Drosophila P elements were discovered because of a...Ch. 13 - Flies homozygous for mutant alleles of a...Ch. 13 - Fred and Mary have a child named Bob. The genomic...Ch. 13 - Uniparental disomy is a rare phenomenon in which...Ch. 13 - Among adults with Turner syndrome, it has been...Ch. 13 - In Neurospora, his2 mutants require the amino acid...Ch. 13 - Human geneticists interested in the effects of...Ch. 13 - The incidence of Down syndrome will be very high...Ch. 13 - The Drosophila chromosome 4 is extremely small;...Ch. 13 - Down syndrome is usually caused by having a...Ch. 13 - Common red clover, Trifolium pratense, is a...Ch. 13 - The numbers of chromosomes in the somatic cells of...Ch. 13 - Prob. 41PCh. 13 - Somatic cells in organisms of a particular diploid...Ch. 13 - An allotetraploid species has a genome composed of...Ch. 13 - Prob. 44PCh. 13 - Chromosomes normally associate during meiosis I as...Ch. 13 - Using whole-genome sequencing, how could you...Ch. 13 - Prob. 47PCh. 13 - Prob. 48PCh. 13 - Seedless watermelons that you find in the...Ch. 13 - The names of hybrid animals are usually themselves...Ch. 13 - While most animals cannot tolerate polyploidy,...Ch. 13 - What characteristic property of translocations...Ch. 13 - Prob. 53PCh. 13 - In the accompanying figure, the top and bottom...Ch. 13 - Prob. 55PCh. 13 - The accompanying figure shows idiograms of human...Ch. 13 - Prob. 57P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c.The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG? d. In general, synonymous polymorphisms tend to be more common than nonsynonymous…arrow_forwardColchicine is a chemical mutagen that inhibits the spindle formation and prevents anaphase, which retains the cell’s single restitution nucleus (doubled chromosome number). Suppose that an onion (2n=16) is subjected to three consecutive rounds of colchicine treatment, what will be the resulting chromosome number of the treated onion?arrow_forwardLid (Little imaginal discs) is a gene located on chromosome 2L and FRT40A refers to an FRT sequence inserted at the 40A (cytological location). Tubulin (Tub) refers to a promoter that can drive target gene expression in all the cell types. Gal80 is an inhibitor of Gal4 that blocks Gal4’s ability to activate transcription. Determine whether the following statements are true or false for flies with the following genotype: y w HsFLP; lid, FRT40A / P{Tub-Gal80}, FRT40A; P{Tub-Gal4} P{UAS-GFP} / + A. The fly will express Gal4, which will activate GFP in all the somatic cells without heat shock. B. After heat shock, FLP recombinase will be induced, which will induce mitotic recombination at FRT40A. However, lid mutant clone will be not induced because it is located closer to the centromere than FRT40A. C. After heat shock, FLP recombinase will be induced, which will induce mitotic recombination at FRT40A, resulting in the generation of homozygous lid mutant clones and twin spots that are…arrow_forward
- ARVC5 is a disorder characterized by the replacement of healthy heart tissue with fatty fibrous tissue. Recent research has discovered the mutated gene that causes the disorder is on chromosome 3. People who have the mutation have a GCG triplet instead of the normal ACA triplet. The following is a section of a gene on chromosome 3: GGT GCG ACA ATT 1. Complete the following table. AA DNA sense strand DNA antisense strand GGT GCG ACA ATT mRNA tRNA 2. Indicate the change in the amino acid sequence resulting from the mutation in the gene described above., B I 123 ||| 14 E GO LG US X₂ x²arrow_forwardConsidering the following chromosome which is represented as a series of genes on each arm separated by the centromere. Describe the type of mutation required to produce each of the mutant chromosomes below. ABCDEFG*HIJKLMNarrow_forwardReferring to image of chromosome 16 below, indicate the exact location of the genes labeled a-k:arrow_forward
- In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field, the DNA of the haploid fungus Neurospora crassa (n = 7) moves slowly but eventually forms seven bands, which represent DNA fractions that are of different sizes and hence have moved at different speeds. These bands are presumed to be the seven chromosomes. How would you show which band corresponds to which chromosome?arrow_forwardView this video. List at least eight (8) different processes that affect the structure of the chromosomes. Explain in a sentence how each process happens. https://www.youtube.com/watch?v=7_p14l8gPhkarrow_forwardBelow is a schematic diagram showing a 3000 bp region of yeast genomic DNA. TSS 5' 3' 5' +1 (i) Draw and name specific regions in this schematic diagram that can be recognized by Transcription factor IID (TFIID). (ii) How does Transcription factor IIH (TFIIH) initiate the transcription? in inarrow_forward
- After salivary gland cells from Drosophila are isolated and cultured in the presence of radioactive thymidylic acid, autoradiography is performed, revealing polytene chromosomes. Predict the distribution of the grains along the chromosomes.arrow_forwardMutations in the HPRT1 gene in humans result in atleast two clinical syndromes. Consult OMIM (www.omim.org) by querying HPRT1; you will only needto look briefly at the top three hits (files #300322,300323, and 308000).a. What is the full name of the HPRT1 enzyme?b. On which chromosome is the HPRT1 gene located?c. Mutations in HPRT1 are associated with two different syndromes. What are these syndromes? Foreach, answer the following questions: (i) What arethe symptoms associated with the syndrome? (ii) Isthe mutant allele that causes the syndrome dominant, recessive, codominant, or incompletely dominant with respect to the normal allele, or do specialconditions apply? (iii) Is the syndrome associatedwith a loss-of-function or a gain-of-function disease allele? (iv) Does the syndrome display allelicheterogeneity? (v) Does the syndrome display locus heterogeneity? (Note: You do not need to understand everything in the OMIM entries to answerthese questions.)arrow_forwardAn STR on chromosome 5 is very closely linked to a gene involved in a dominant metabolism disorder (one one copy of the mutation causes the disease). There are four different alleles of the STR (Q, B, S, and L), each with different numbers of GATCTCG repeats. The S allele has 2 repeats, the B allele has 7 repeats, the Q allele has 10 repeats, and the L allele has 5 repeats. Part 1 Lane 1 of the gel shown below indicates the locations of PCR products corresponding to all four STR alleles when run together in one lane. DNA was loaded into the wells at the top of the gel. Move the letter of each allele to its correct position at the left of Lane 1 to indicate where each allele runs on the gel. 0000 Gabriel Andre Lane 1 O Maria Andre Maria Juliana B L Part 2 Andre and Maria are the parents in this family; all others shown on the gel are children. Daughter Juliana is born with the metabolism disorder, but daughter Camila does not have the disorder. Assuming no recombination between the STR…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY