Concept explainers
Core Skill: Modeling The goal of this modeling challenge is to increase the complexity of the model shown in Figure 13.8d by including sequences in the crRNA and bacteriophage DNA that bind to each other.
Modeling Challenge: For simplicity, the structure of the crRNAs in Figure 13.8 is shown shorter than it really is. Let’s suppose that the part of a crRNA that recognizes the bacteriophage DNA is 20
Figure 13.8 The CRISPR-Cas system of genome defense in bacteria. The system shown here is a type II system, which is found in the chromosome of certain bacterial species but not in archaea. (a) Organization of the CRISPR-Cas system in a bacterial chromosome. This drawing shows a typical organization, but different species have variations. (b–d) A simplified mechanism of the CRISPR-Cas system. The defense occurs in three phases, called adaptation, expression, and interference.
Want to see the full answer?
Check out a sample textbook solutionChapter 13 Solutions
BIOLOGY (LL)
- INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: RNA splicing is the step in post transcriptional processing where intervening sequences are removed STAMENT 2: 5’ to 3’ direction is the direction of growth of the peptide chain ANSWER: STAMENT 1: The enzyme that joins the gaps in newly synthesized DNA is called DNA polymerase STAMENT 2: The name of the compound formed when cytosine is bonded to ribose is cytidine ANSWER: STAMENT 1: Codon is a term that refers to the 3-nucleotide code for amino acids in mRNA STAMENT 2: Transition is a kind of mutation where a purine changes to another purine ANSWER:arrow_forwardTask #2: Examine the gene, transcript and polypeptide sequences Next, it's important to understand how the gene would be transcribed and translated. A 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac cgagacctgg gccggtgagt gcgggtcggg agggaaatgg 121 cctctgccgg gaggagcgag gggaccgcag gcgggggcgc atgacctcag gagccgcgcc 181 gggaggaggg tcgggcgggt ctcagcccct cctcaccccc aggctcccac tccatgtggt 241 atttctacac ctccgtgtcc cggcccqgcc gcggggagcc ccgcttcatc tcagtgggct 301 acgtggacga cacccagttc gtgaggttcg acagcgacgc cgcgagtccg agagaggagc 361 cgcgggcgcc gtggatagag caggaggggc cggagtattg ggaccggaac acacagatct 421 acaaggccca ggcacagact gaccgagaga gcctgcggaa cctgcgcttc tactacaacc 481 agagcgaggc cgttgcgtga ccccggcccg gggcgcaggt cacgactccc catcccccac 541 gtacggcccg ggtcgccccg agtctccggg tccgagatcc gcctccctga ggccgcggga a) coding region i) What is the length of the coding region (in nucleotides)? ii) Explain how you arrived at your answer for (i). iii) Which nucleotides…arrow_forwarddiscuss using named examples some of the disadvantages of protein engineering using site directed and random mutagenesisarrow_forward
- INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: UGA, UAG and UCG are termination codon STAMENT 2: Missense mutation is a type of mutation that changes the coded amino acid ANSWER: STAMENT 1: Binding of RNA primer to the DNA is the first step in the transcription cycle STAMENT 2: Translation refers to the synthesis of proteins using the information contained in mRNA ANSWER: STAMENT 1: The carbon number in ribose where guanine is connected is 1 STAMENT 2: The other name for unprocessed eukaryotic RNA is raw nuclear RNA ANSWER:arrow_forwardTrue or False. 1. a.) RNA polymerase decodes mRNA so the ribosome can make proteins. b.) Only coding RNA can interact with the ribosome. c.) The ribosome is composed of both protein and ncRNA. d.)The ncRNA components of the ribosome behave as a ribozyme. Pick one of the FALSE statements from the 4 previous questions and explain why it is incorrect.arrow_forwarddiscuss using named examples some of the advantages and disadvantages of protein engineering using site directed and random mutagenesisarrow_forward
- 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forwardTopic: Splicing a. What is the big picture of splicing and what is the importance of this concept in biology?b. What are the processes that are controlled or regulated or affected by this concept and why must these processes be controlled or regulated in the first place?arrow_forwardSituational task: As a result of intoxication, enzymes that provide splicing are not synthesized in liver cells. What is the reason for stopping protein biosynthesis in this case? Justify the answerarrow_forward
- RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…arrow_forwardGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forwardQuestion: how does the flu without the track arise and what does it mean male type splicing if the flu protein isn't present in females?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education