BIOLOGY (LL)
5th Edition
ISBN: 9781264115495
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13, Problem 2CQ
What is RNA interference (RNAi)? Explain how the double-stranded RNA is processed during RNAi and how it leads to the silencing of a complementary mRNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why does using them make sense based on the processing (or modification) of precursor mRNA to get mature mRNA?
Introns are often very large and the cell has devoted mechanisms of eliminating them once they are excised from the pre-mRNA. Following intron excision, what specific ribonucleolytic enzymes or complexes contribute to eliminating the intron RNA immediately after it is excised from the pre-mRNA? Briefly describe the role of each step/enzyme and how it affects its RNA substrate
What is mean by RNA editing ?
Chapter 13 Solutions
BIOLOGY (LL)
Ch. 13.1 - Prob. 1CCCh. 13.2 - Prob. 1CCCh. 13.3 - Prob. 1EQCh. 13.3 - Prob. 2EQCh. 13.3 - Prob. 3EQCh. 13.3 - Effects of Non-coding RNAs on Translation and mRNA...Ch. 13.4 - Non-coding RNAs and Protein Sorting Core Skill:...Ch. 13.5 - Core Skill: Modeling The goal of this modeling...Ch. 13 - Prob. 1TYCh. 13 - Prob. 2TY
Ch. 13 - Prob. 3TYCh. 13 - Prob. 4TYCh. 13 - Prob. 5TYCh. 13 - Prob. 6TYCh. 13 - With regard to miRNAs and siRNAs, which of the...Ch. 13 - Cas1 and Cas2 proteins play a role during which of...Ch. 13 - Which of the following components bind to...Ch. 13 - Abnormalities in the expression of ncRNAs are...Ch. 13 - An ncRNA may have one or more of the following...Ch. 13 - What is RNA interference (RNAi)? Explain how the...Ch. 13 - Prob. 3CQCh. 13 - Prob. 1COQCh. 13 - Go to the PubMed website and search for non-coding...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If an antisense RNA is designed to silence the following mRNA sequence, which of the following antisense oligos (a-d) could be used for this purpose? mRNA sequence: 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' AUCCUGAUAAUUCCAUGUAAAUAA 3' O 5' AAUGGGUGUACCUUAAUAGUCCUA 3' O 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' UUACCCACAUGGAAUUAUCAGGAU 3¹arrow_forwardDefine RNA interference (RNAi).arrow_forwardA normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)arrow_forward
- ) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).arrow_forwardWhat is a functional consequence of RNA editing?arrow_forwardProkaryotic mRNAs have a RBS (Ribosomal binding site). How they use RBS for translational machinery? What are the properties of RBS? Draw a simple scheme for RBS and mRNA interaction site.arrow_forward
- During periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how eIF2 can mediate both the suppression of translation of non-essential mRNAs and ensure that essential mRNAs continues to be translated.arrow_forwardThe mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?arrow_forwardList several ways in which RNA is processed after transcription.arrow_forward
- The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: capping cleavage of polycistronic mRNA removal of poly A tails reverse transcription splicingarrow_forwardwhat is the difference between leader mRNA and attenuator sequence? Please explain the function of attenuator sequence in attentuationarrow_forwardList three molecular changes that take place in the processing of eukaryotic mRNA.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license