Genetic Analysis: An Integrated Approach Plus Mastering Genetics with Pearson eText -- Access Card Package (3rd Edition) (What's New in Genetics)
3rd Edition
ISBN: 9780134807799
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 14, Problem 17P
How would you perform a genetic screen to identify genes directing Drosophila wing development? Once you have a collection of wing
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A wild type strain of Drosophila was found to carry a transposable element called copia.From this strain (red eyed), a white-eyed strain was obtained in which the copia element hadtransposed to a region on the X-chromosome that corresponded to where the eye-color genemapped. How would you clone the eye-color gene and confirm your discovery?
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.
You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?
You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?
5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’
3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’
After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
How would you devise a screen to identify recessive mutations in Drosophila that result in embryo lethality? How would you propagate the recessive mutant alleles?
Chapter 14 Solutions
Genetic Analysis: An Integrated Approach Plus Mastering Genetics with Pearson eText -- Access Card Package (3rd Edition) (What's New in Genetics)
Ch. 14 - 14.1 What are the advantages and disadvantages of...Ch. 14 - Prob. 2PCh. 14 - Discuss the similarities and differences between...Ch. 14 - 14.5 What are the advantages and disadvantages of...Ch. 14 - 14.6 You have cloned the mouse ortholog (see...Ch. 14 - 14.7 Diagram the mechanism by which CRISPRCas...Ch. 14 - 14.8 Describe how CRISPRCas has been modified to...Ch. 14 - 14.9 Discuss the advantages (and possible...Ch. 14 - 14.10 Discuss the advantages (and possible...Ch. 14 - You have identifies a gene encoding the protein...
Ch. 14 - You have identified a recessive mutation that...Ch. 14 - 14.13 The CBF genes of Arabidopsis are induced by...Ch. 14 - 14.14 When the S. cerevisiae genome was sequenced,...Ch. 14 - 14.15 Translational fusions between a protein of...Ch. 14 - 14.16 In humans, Duchenne’s muscular dystrophy is...Ch. 14 - 14.17 How would you perform a genetic screen to...Ch. 14 - In enhancer trapping experiments, a minimal...Ch. 14 - 14.19 In Genetic Analysis, we designed a screen to...Ch. 14 - How would you design a genetic screen to find...Ch. 14 - 14.21 The eyes of Drosophila develop from imaginal...Ch. 14 - 14.22 Given your knowledge of the genetic tools...Ch. 14 - Mutations in the CFTR gene result in cystic...Ch. 14 - 14.24 How would you clone a gene that you have...Ch. 14 - 14.25 How would you conduct a screen to identify...Ch. 14 - In land plants, there is an alternation of...Ch. 14 - 14.27 The Drosophila evenskipped (eve) gene is...Ch. 14 - Prob. 28PCh. 14 - 14.29 As shown in Figure, mutations in the...Ch. 14 - How would you edit a specific nucleotide in a...Ch. 14 - Through a forward genetics screen in Arabidopsis...Ch. 14 - The CRISPR - Cas 9 complex directs the Cas 9...Ch. 14 - 14.33 Describe how enhancer screens can be used to...Ch. 14 - How might you use CRISPR - Cas 9 to create a large...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You want to clone a eukaryotic gene and express the corresponding protein in yeast. However, the protein typically localizes within mitochondria. How will you perform your gene cloning so that the protein is secreted from the cell, rather than localized within yeast mitochondria?arrow_forwardDescribe how you would use replica plating of mutagenized, haploid yeast cells to identify temperature-sensitive (ts) mutations in essential genes needed for yeast growth and survival.arrow_forwardSuppose that you have just graduated from college and have started working at a biotechnology firm. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; however, the mouse gene for prolactin has been cloned, and the amino acid sequence of mouse prolactin is known. Briefly explain two different strategies that you might use to find and clone the pig gene for prolactin.arrow_forward
- Next-generation sequencing reveals that six new mutations have occurred in the coding regions of genes in an individual diploid fly. If the coding regions of this fly comprise 100 million nucleotides per haploid genome, what is the mutation rate per nucleotide?arrow_forwardWhat are site-recombinases? Describe in detail how cre- recombinase can be used to decipher the roles of specific genes and proteins in complex multicellular organisms? Explain how the cre-lox system can be used to examine the role of a particular gene in a specific type of tissue?arrow_forwardThere is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods, steps, and key substances you need to obtain to use the following techniques in experimental design to study the gene: - In situ hybridization (to find the mRNA) - Immunohistochemistry (to find the protein) - CRISPR-Cas9 (for loss of function) - Expression vector (for gain of function)arrow_forward
- As an alternative to random mutagenesis, scientistscan screen for mutant phenotypes by knocking downindividual gene functions systematically using RNAi.a. Suggest ways to construct transgenes that in flieswould express RNAi to knock down a gene.b. How could you perform a mutant screen for fly genesrequired for wing development using RNAi? Howcould this screen avoid the problem of pleiotropy?arrow_forwardExpression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? please try to explain a bit elaborately.arrow_forwardYou just graduated from college and started working at a biotech startup called Scrofabulous. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; What would be the most useful and economical first step to go about identifying and cloning the pig gene for prolactin? use the amino acid sequence of mouse prolactin to design a pair of degenerate oligonucleotide PCR primers to PCR-amplify the pig prolactin gene. RNAseq the pituitary gland of the pig, the most abundant gene is likely to to be prolactin Conduct a proteome search for peptides that match parts of mouse prolactin protein Sequence the pig genome, then translate the genome to find the gene predicted to encode for prolactin Crystalize the mouse prolactin protein and use Google's DeepMind Al to find the closest amino acid sequence in the pig proteomearrow_forward
- Discuss how ultra violet light works as a mutagen. This could include: What is UV light and the Mutations commonly introduced by UV light? What are the Repair mechanisms in yeast that fix damage caused by UV light? Describe the phenotypes of Saccharomyces Cerevisiae plates, the first plate is the control yeast, while the second plate has been exposed to low UV light, the third plate has been exposed to high UV light. Normal yeast has round smooth white colonies. Are there any signinifcant differences?arrow_forwardexpression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use.in an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. will this strategy result in good expression of gene X? why or why not?arrow_forwardConsider the microarray in Figure 20.12. If a sample from normal tissue is labeled with a green fluorescent dye and a sample from cancerous tissue is labeled red, what color spots would represent genes you would be interested in if you were studying cancer? Explain.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY