BIOLOGY
12th Edition
ISBN: 9781264839698
Author: Raven
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 17, Problem 1A
Summary Introduction
Introduction: Polymerase chain reaction (PCR) is a technique used to amplify a particular DNA sequence. Reverse transcriptase quantitative PCR (RT-qPCR) is one of the easiest and fastest methods used to measure relative changes in the expression of the gene.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’
a. What is the complementary strand?
b.Deduce the mRNA in this coding region.
c.What is the amino acid sequence based on this mRNA?
d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference
Nuclear (N) and cytoplasmic (C) mRNA samples of a gene with 2 exons and one intron run on
an agarose gel along with a size marker, are shown in the gel figure below.
Ntds = nucleotides
3.
What is the length of the primary mRNA? HINT:
Check question 3c
RNA sample: N
a.
C
ntds
1900-
b. What is the length of the processed MRNA?
1250
1000
800-
650
с.
If the 1250 nucleotide and 650 nucleotide fragments
are spliced mRNA intermediates as indicated in the
splicing diagram below, what is the size in nucleotides
of Exon 1 & Exon 2.
Size
1
Markers
Exon
Intran
Exon
pre-MRNA
AG
GU
(1)
(2)
I
spliced
MRNA
2.
Chapter 17 Solutions
BIOLOGY
Ch. 17.1 - Prob. 1LOCh. 17.1 - Prob. 2LOCh. 17.1 - Describe the construction and uses of recombinant...Ch. 17.2 - Relate the process of DNA replication to PCR.Ch. 17.2 - Compare and contrast PCR, RT-PCR, and quantitative...Ch. 17.3 - Prob. 1LOCh. 17.3 - Prob. 2LOCh. 17.3 - Describe the pros and cons of RNA interference and...Ch. 17.4 - Explain how the universal nature of the genetic...Ch. 17.4 - Compare and contrast knockout, knockin, and...
Ch. 17.4 - Prob. 3LOCh. 17.5 - Describe the benefits of biofuel production from...Ch. 17.5 - Prob. 2LOCh. 17.5 - Prob. 3LOCh. 17.6 - Prob. 1LOCh. 17.6 - Compare and contrast FISH and gene chip...Ch. 17.6 - Describe how immunoassays can be used to diagnose...Ch. 17.7 - Describe the benefits of creating transgenic...Ch. 17.7 - Prob. 2LOCh. 17.7 - Evaluate issues on each side of the transgenic...Ch. 17 - Prob. 1DACh. 17 - Prob. 2DACh. 17 - Prob. 1IQCh. 17 - Prob. 2IQCh. 17 - You study a gene known to be important in the...Ch. 17 - What is the basis of separation of different DNA...Ch. 17 - Prob. 3UCh. 17 - FISH analysis of a breast tumor biopsy for HER2...Ch. 17 - In terms of studying gene function, what is the...Ch. 17 - The Ti plasmid of Agrobacterium usually induces...Ch. 17 - Prob. 1ACh. 17 - Which of the following statements is accurate for...Ch. 17 - Prob. 3ACh. 17 - Many human proteins, such as hemoglobin, are only...Ch. 17 - Amyloid beta is a proteolytic product of a protein...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference 5’ CTATATTTATGTGCTATATCCAGGACTGCCCCTAGGAAATAAAAAA…AAAAAAA 3’3’ GATATAAATACACGATATAGGTCCTGACGGGGATCCTTTATTTTTT…TTTTTTT 5’arrow_forwardYou synthesized 3 pre-mRNAs, as shown, performed splicing in a test tube, and monitored the splicing reaction on a gel by autoradiography. What can you conclude from this data? Select all that apply. You may select multiple options. These pre-mRNAs were incubated with a nuclear extract and splicing over time (0-120 min) was followed by gel electrophoresis. m7GpppG 0 30 60 120 O None of these options m'Gppp 13- Gppp 13- (uncapped)13- GpppG 0 30 60 120 O Cap affects the splicing of the second intron O Cap affects the splicing of the first intron Cap affects splicing of all introns Cap has no effect on splicing exon intron uncapped 0 30 60 120 min Fig. 15.29 13 14 13 14 15 (0) 15 13 14 13 14 15 (4) 15 (0) Fig. 15.30arrow_forwardA peptide is produced in two different cells. The primary structure is the same in both cells, but the amount of peptide is increased in one cell. What could be happening to the pre-mRNA or mRNA transcript within the cell that has the higher amount of this peptide? A. It has a shorter Poly-A tail B. An alternative polyadenylation (Poly-A) site is being selected C. Leaky scanning occurred D. B and C are both correct OE. None of the abovearrow_forward
- The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forwardWhich of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp d. 100bparrow_forwardYou sequence a gene of interest and isolate the matching mRNA. You find that the mRNA is considerably shorter than the DNA sequence. Why is that?arrow_forward
- In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter? (More than one may apply). A. Synthetic mRNA B. DNA C. Anti-codons D. Radioactive amino acids E. Large ribosomal subunits F. Small ribosomal subunitsarrow_forwardProcedure This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the following sequences of the first thirty (30) nucleotides: TAC CAC GTG GAC TGA GGA CAC CTC TTC AGA... 1. First transcribe the DNA sequence into the mRNA sequence. 2. Refer to the genetic code to write down the amino acid sequence that these 30 nucleotides encode beginning with the first nucleotide. 3. Generate a random number (1-30) by drawing lots in a bowl. Then locate the DNA nucleotide to "mutate" using the number drawn as the position along the gene. 4. "Roll" the tetrahedron "mutator" dice (see direction below for making the tetrahedron "mutator" dice). Note the letter on the side that is flat on the table. That is the nucleotide that will replace the nucleotide in the DNA at the position decided in the previous step. 5. Write the mutant nucleotide sequence in the row for Mutation 1, then analyze mutation. a. If it is the same nucleotide, write same nucleotide…arrow_forwarda. The promoter is to the right so transcription goes right to left.b. This sequence 5’ AGCTACGGGGTG 3’ is a part of the template strand from the MIDDLE of gene. Write it in the middle of one of your lines. Use pencil in case of errors. c. Write the sequence of the coding strand of DNA on the other line. d. Indicate the start of transcription with an arrow like this and write “promoter” where it must be located. e. Draw a thicker (or different colored) line to indicate a strand of newly synthesized mRNA. Label 5’ and 3’ ends. By the template sequence on your diagram, write the sequence of mRNA that is produced from this template. f. In what ways are the sequences of the coding strand and the mRNA similar? g. In what ways are the coding strand and the mRNA different?arrow_forward
- a. What is grey donut shaped object supposed to represent? b. Label with the word "promoter" where one might find the promoter region in this image. c. In the magnified insert, label the template strand that is being transcribed with the word "template". d. In the magnified insert label the 5' and 3' ends of the transcript. e. What entity functions to break the complementary base pairing of a gene at its transcription start site? CS Scanned with CamScannerarrow_forwardDescribes a method known as Western blotting that can be used to detect a polypeptide that is translated from a particular mRNA. In this method, a particular polypeptide or protein is detected by an antibody that specifically recognizes a segment of its amino acid sequence. After the antibody binds to the polypeptide within a gel, a secondary antibody (which is labeled) is used to visualize the polypeptide as a dark band.For example, an antibody that recognizes α-galactosidase A couldbe used to specifically detect the amount of α-galactosidase A proteinon a gel. The enzyme α-galactosidase A is defective in individuals with Fabry disease, which shows an X-linked recessive pattern of inheritance. Amy, Nan, and Pete are siblings, and Pete has Fabry disease. Aileen, Jason, and Jerry are brothers and sister, and Jerry has Fabry disease. Amy, Nan, and Pete are not related to Aileen, Jason, and Jerry. Amy, Nan, and Aileen are concerned that they could be carriers of a defective…arrow_forwardFor each of the following sequences, place a check mark in the appropriate space to indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence). Process most immediately affected by deletion Sequence deleted Replication Transcription RNA processing Translation a. ori site _____ _____ _____ _____ b. 3′ splice site consensus _____ _____ _____ _____ c. Poly(A) tail _____ _____ _____ _____ d. Terminator _____ _____ _____ _____ e. Start codon _____ _____ _____ _____ f. -10 consensus _____ _____ _____ _____ g. Shine–Dalgarno _____ _____ _____ _____arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY