BIOLOGY
4th Edition
ISBN: 9781266739606
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 1WIO
Explain why the antibiotics penicillin and polymyxin are not effective against archaea. (Review this chapter's Apply It Now box.)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below:
>UnknownSequence1
GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC
GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
A colleague is struggling understanding how bacteria can be beneficial to humans. Please discuss two ways how this is possible and provide valid support with examples.
go to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below.
Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year?
What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone.
What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year?
Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year?
Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…
Chapter 17 Solutions
BIOLOGY
Ch. 17.1 - What are two domains that contain prokaryotes?Ch. 17.1 - Prob. 2MCCh. 17.1 - Prob. 3MCCh. 17.1 - Why are most species of prokaryotes little...Ch. 17.2 - Prob. 1MCCh. 17.2 - Prob. 2MCCh. 17.2 - What does the Gram stain reveal about a cell?Ch. 17.2 - Prob. 4MCCh. 17.2 - How are molecular data changing microbial...Ch. 17.2 - Prob. 6MC
Ch. 17.3 - Prob. 1MCCh. 17.3 - Prob. 2MCCh. 17.3 - Prob. 3MCCh. 17.4 - Prob. 1MCCh. 17.4 - Prob. 2MCCh. 17.4 - What adaptations enable pathogenic bacteria to...Ch. 17.4 - What are some practical uses of bacteria and...Ch. 17.5 - Prob. 1MCCh. 17.5 - Prob. 2MCCh. 17 - A prokaryotic cell is one that a. lacks DNA. b....Ch. 17 - Which of these is a distinguishing characteristic...Ch. 17 - What feature distinguishes the cell walls of...Ch. 17 - What type of organism may use inorganic chemicals...Ch. 17 - Prob. 5MCQCh. 17 - Prob. 6MCQCh. 17 - Prob. 7MCQCh. 17 - Prob. 8MCQCh. 17 - Explain why the antibiotics penicillin and...Ch. 17 - Why do some microbiologists disagree with...Ch. 17 - Give five examples that illustrate how bacteria...Ch. 17 - If you were developing a new "broad-spectrum"...Ch. 17 - Describe your own metabolic classification: Are...Ch. 17 - A prokaryote with which type of metabolism would...Ch. 17 - Ernst Mayr defined a biological species as a...Ch. 17 - Why did the discovery of archaea generate interest...Ch. 17 - In an article in Nature magazine, Sean Nee wrote...Ch. 17 - Ecosystems rely on nitrogen -fixing bacteria,...Ch. 17 - Prob. 11WIOCh. 17 - Prob. 12WIOCh. 17 - Prob. 13WIOCh. 17 - Prob. 14WIOCh. 17 - Prob. 15WIOCh. 17 - Mycobacterium tuberculosis causes most cases of...Ch. 17 - Prob. 1PITCh. 17 - Add autotrophs, heterotrophs, phototrophs, and...Ch. 17 - Prob. 3PITCh. 17 - Create a new concept map that includes the...Ch. 17 - Prob. 4PITCh. 17 - Prob. 6PIT
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
Define histology.
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (6th Edition) - standalone book
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Briefly discuss what is the link between food, Listeria monocytogenes and phages Kindly check the attached imagearrow_forwardGive typing answer with explanation and conclusion . Which of the following statement is INCORRECT? A. Zoonotic diseases are diseases transmitted from animals to humans B. One source of antibiotic-resistance genes is the original antibiotic-producing organisms themselves. C. Nosocomial diseases are diseases one acquires while staying in a healthcare facility. D. A virus with a high LD50 is likely to spread rapidly and become pandemic.arrow_forwardWhat is an original research? Do you think the following are ideas that may be considered as original? Support your answer with logical reasons in each case : a. Investigation of size of bacterial cells b. Evaluation of impact of CO2 on the environment c. Diversity of microorganisms in the fields of Kohat University d. Investigation of new compounds in a bacterial culture e. Application of a strain of bacteria you isolated from the soil as PGPRarrow_forward
- Give typed full explanation Using a reference source, describe the contributions of the following men made to medicine, especially regarding surgical asepsis: 1. Ignaz Semmelweis 2. Louis Pasteur 3. Joseph Listerarrow_forwardProvide evidence in supporting or refuting the following statement: The cell, or cytoplasmic membrane, is a nonessential structure in bacteria because its function is replaced by the cell wall in these microbes. provide at least 400 of wordsarrow_forwardQUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forward
- Prepare a detailed and concise review article linking the viral infection SARS CoV2 (COVID-19) to the outbreak of the fungal infection mucormycosis that occurred in India. In this review you should discuss and describe the two pathogens, and the molecular mechanisms underpinning why patients developed a secondary mucormycosis infection 2000-2500 words please and include references and diagrams where neededarrow_forwardThere are three main ways that bacteria and archaea are essential to eukaryotic life. Explain the three different ways and give at least one example of each.arrow_forwardProvide evidence in supporting or refuting the following statement: The cell, or cytoplasmic membrane, is a nonessential structure in bacteria because its function is replaced by the cell wall in these microbes. please provide minimum of 400 of words. Thank you!arrow_forward
- consider the following terms: Envelope Fusion Gene therapy Pathogen Vaccine Capsule Decomposer Epidemic Mold Spore Yeast Choose 2 terms from the list and answer the following questions for each term: What familiarity and prior knowledge do you have about the term? What does the term mean in everyday language to everyday people? Use examples to help describe your thoughts. How do people use the word? What does the term mean in technical language to biologists? How is the term related to the course student learning outcome: Describe classifications of biological diversity? What are the similarities and differences between the everyday and technical meanings and uses of the term? What impact might the similarities and differences have on your learning of biology concepts in this course?arrow_forwardcan you explain why Bacillus anthracis can be pathogenic in a mouse and not be fought off by the immune system? I need help finding the answer in the article and explain in short answer link to article: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/arrow_forwardGive typing answer with explanation and conclusion The antibiotic bacitracin binds to bactoprenol after it inserts a peptidoglycan monomer into a bacterial cell wall. Explain why this would lead to the death of the bacterium. 2. Penicillin antibiotics bind the bacterial enzyme transpeptidase. Explain why this would lead to the death of the bacterium. 3. Could either of the above antibiotics be used to treat protozoan infections such as giardiasis & toxoplasmosis? Why/Why notarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Explore Terrestrial Habitats - Types of Habitats for Children; Author: Smile and Learn - English;https://www.youtube.com/watch?v=vv1indKgOHQ;License: Standard youtube license