![EBK CONCEPTS OF GENETICS](https://www.bartleby.com/isbn_cover_images/9780134818979/9780134818979_largeCoverImage.gif)
Concept explainers
(a)
To determine: The way by which deletion within the GAL4 gene would affect transcription of the yeast GAL1 gene in the presence of galactose.
Introduction: Transcription is the process of formation of RNA (ribonucleic acid) from the complementary DNA (deoxyribonucleic acid). GAL genes are required for the proper growth of yeast in galactose medium. The regulation of GAL genes is regulated by the products of GAL4, GAL8, and GAL3 genes. Mutation in these regions may disrupt the process of transcription in yeast.
(b)
To determine: The way by which deletion within the entire GAL3 gene would affect transcription of the yeast GAL1 gene in the presence of galactose.
Introduction: As mentioned in the concept introduction part a.
(c)
To determine: The way by which deletion of a mutation within the GAL80 gene that blocks the ability of Gal80 protein to interact with Gal3p would affect transcription of the yeast GAL1 gene in the presence of galactose.
Introduction: As mentioned in the concept introduction part a.
(d)
To determine: The way by which deletion of one of the four UASG elements upstream from the GAL1 gene would affect transcription of the yeast GAL1 gene in the presence of galactose.
Introduction: As mentioned in the concept introduction part a.
(e)
To determine: The way by which a point mutation in the GAL1 core promoter that alters the sequence of the TATA box would affect transcription of the yeast GAL1 gene in the presence of galactose.
Introduction: As mentioned in the concept introduction part a.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 17 Solutions
EBK CONCEPTS OF GENETICS
- Consider the mechanism of the enzyme RNase: What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain. What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.arrow_forwardDescribe how transcription would be affected in the Galactose metabolizing pathway in Yeast in the presence of the following mutations. 1. A mutation that resulted in an inability of Gal80 to enter the nucleus. 2. A mutation that resulted in a lack of ability of Gal3 to bind galactose.arrow_forwardWhy is it adaptive for the structural genes for using lactose to be under the control of a single promoter (i.e., synthesize a polycistronic message rather than three monocistronic messages)? a. For efficient absorption and catabolism of lactose, structural genes send a single signal. This is why polycistronic message is favored more than the monocistronic message since the former involves transmission of numerous messages in initiation and termination. b. Polycistronic message is favored more than the monocistronic message. c. Polycistronic message is favored more than the monocistronic message since the former involves transmission of numerous messages in initiation and termination. d. For an efficient absorption and catabolism of lactose, structural genes send a single signal only. e. Polycistronic message is favored more than the monocistronic message since the former involves transmission of single message in initiation and termination.arrow_forward
- If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardGive typing answer with explanation and conclusion a) List three eukaryotic gene expression mechanisms that do not occur in prokaryotes. For two of these, give specific examples and the functional outcomes. b) Describe what is meant by the term “RNA silencing”. c) Using diagrams, give two examples of RNA silencing mechanisms and indicate one difference.arrow_forwardShown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it could arise from overlapping genes, how many different polypeptide sequences can be produced? Using the chart in Figure 12–7, what are the sequences? (b) A base-substitution mutation that altered the sequence in part (a) eliminated the synthesis of all but one polypeptide. The altered sequence is shown below. Use Figure 12–7 to determine why it was altered. 5′-AUGCAUACCUAUGUGACCCUUGGA-3′arrow_forward
- Select the following descriptions of gene transcription regulation in eukaryotes that are post-translational: Select 2 correct answer(s) O A) Length of poly A tail B) Chromatin modification C) Destruction of protein before/after modifications by a proteosome U D) Alternative splicing of mRNA molecule E) Acetylation of histone tails F) Binding of activators to enhancers regions on the DNA G) destruction of mRNA by RNA interference O H) DNA methylation UI) Addition of functional groups to a fully formed proteinarrow_forwardRegarding the process of gene transcription in eukaryotes, it is correct to state that A)The transcription process is terminated when the RNA polymerase complex reaches the final region of the gene with the poly-adenylation signal. B)The RNA polymerase II transcription elongation complex contains transcription factors such as the TATA box binding protein C)The opening of the region of DNA that will be transcribed is done by the DNA helicase, present in the transcription complex. D)The main function of the Mediator coactivator is to promote the transition between elongation and completion of the transcription process. E)Different activators and repressors can influence the transcriptional elongation complex by binding to the promoter regions of genesarrow_forwardSelect the following descriptions of gene transcription regulation in eukaryotes that are post-transcriptional/pre-translational: Select 3 correct answer(s) A) Acetylation of histone tails B) Length of poly A tail C) Alternative splicing of mRNA molecule D) Binding of activators to enhancers regions on the DNA E) Addition of functional groups to a fully formed protein F) DNA methylation G) Chromatin modification H) Destruction of protein before/after modifications by a proteosome I) destruction of mRNA by RNA interferencearrow_forward
- A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein. a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria. b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?arrow_forwardShown below is a schematic diagram illustrating a very short gene with 5000 bp region of an unknown Schizosaccharomyces pombe genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS 5. 3' 3 +1 (i) Name the specific regions that can be recognized by Transcription Factor IID (TF ID) and indicate the locations in the diagram above. (ii) List the mechanistic steps that can trigger the initiation of transcription by Transcription Factor IIH (TF IIH).arrow_forwardA membrane-associated protein kinase has the sequence -GMCLVS at its C-terminus, which has been shown by mutagenesis to be essential for its biological function and sub cellular location.a) What is the most likely post-translational modification that this motif would be susceptible to?b) How is this modification introduced to the protein?c) What is the likely effect of this modification on the behaviour of the protein?d) What other modification to N-terminus of the protein might achieve a similar effect on the behaviour of the protein?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)