CAMPBELL BIOLOGY,VOL.II >CUSTOM<
17th Edition
ISBN: 9781323803677
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17.4, Problem 4CC
WH AT IF? → In eukaryotic cells, mRNAs have been found to have a circular arrangement in which proteins hold the poly-A tail near the 5' cap. How might this increase translation efficiency?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
WHAT IF? In eukaryotic cells, mRNAs have been foundto have a circular arrangement in which proteins holdthe poly-A tail near the 5¿ cap. How might this increasetranslation efficiency?
Yes or no?
Is sequence of riboprobe identical to the mrna produced by gene in situ hybridization?
does column of purification in DNA allow it to flow while other molecules are trapped ?
Open reading frames...
correspond to introns, which are not read by the ribosome during translation
correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame
correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames
are often rich in acetylated histones which allow transcription
occur when fragments of DNA sequence are highly similar between two species
are recognized by ribosomes to initiate translation
Chapter 17 Solutions
CAMPBELL BIOLOGY,VOL.II >CUSTOM<
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 17.3 - There are about 20,000 human protein-coding genes....Ch. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CCCh. 17.4 - What two processes ensure that the correct amino...
Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Which of the following is not true of a codon? (A)...Ch. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Which of the following is not true of RNA...Ch. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - scientific inquiry Knowing that the genetic code...Ch. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (4th Edition)
Describe the evolution of mammals, tracing their synapsid lineage from early amniote ancestors to true mammals....
LooseLeaf for Integrated Principles of Zoology
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
Marine Biology (Botany, Zoology, Ecology and Evolution)
Identify each of the following reproductive barriers as prezygotic or postzygotic. a. One lilac species lives o...
Campbell Essential Biology with Physiology (6th Edition)
Describe Mendels conclusions about how traits are passed from generation to generation.
Concepts of Genetics (11th Edition)
Nursing Student with Neuropathic Pain
Tamara Costa broke her right tibia and has undergone two separate surger...
Human Anatomy & Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give typed full explanation Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’arrow_forward5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?arrow_forwardVISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.arrow_forward
- Translation What are the stop/nonsense codons? How is the growing polypeptide released from the ribosomal assembly?arrow_forwardHELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.arrow_forwardSA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omissarrow_forward
- Q10. Does frame +2 have an ORF in the coding region of this exon? What about frame +1 and frame +3? Q11. Given that 3 of the 64 possible codons are stop codons, what is the chance of having a stop codon at any given position, assuming that the sequence is random?arrow_forwardRefer to the codon diagram on. Which of the following is a codon that will terminate translation?* ates es Ders rences anline Gly (G) Leu (F) Ser (S) Ty 3. Asp (E) (D) C la Ala (A) GU Cys (C) eriods 1 and 2 G ds P1, Highschool pol MP3, P4 Trp (W) AC Arg (R) Leu (L) Ser (S) Lys (K) C. Pro Asn (N) (P) His The (H) Thu Fri Gin (0) INTLarrow_forwardSelect all the examples of mutations that are likely to have a global effect on gene expression. e to search * W Check All That Apply # 3 E a mutation in a splice donor recognition sequence within an snRNA gene a hypomorphic mutation in the catalytic site of RNA polymerase a silent mutation in a gene encoding a protein in the small ribosomal subunit 14 $ IDI 4 O R f5 % i 5 ved partial credit in the previous attempt. T ^ ?b f10 83°F Mc O f1arrow_forward
- The subunits of the translation initiation complex in PROKARYOTES.* 1 point O 30S and 50S O 40S and 60S O 20S and 60S O 10S and 70S Normal pH of the human blood? * 1 point O 7.30 to 7.40 O 7.35 to 7.45 O 7.40 to 7.50 O 7.45 to 7.55 A structural motif that contains 2 cysteine and 2 histidine amino acids. * I point Helix-turn-helix Motifarrow_forwardYes or no? for each gene, transcription is initiated at origin of replication. does pre mrna shorter than mrna? Does one thousand microliters less than a milliliter?arrow_forwardWHAT IF? DRAW IT Draw a tRNA with the anticodon3¿-CGU-5¿. What two different codons could it bind to?Draw each codon on an mRNA, labeling all 5¿ and 3¿ends, the tRNA, and the amino acid it carries.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY