![Campbell Biology: Custom Edition](https://www.bartleby.com/isbn_cover_images/9781323717271/9781323717271_smallCoverImage.jpg)
Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 18, Problem 18.3CR
Why are miRNAs called noncoding RNAs? Explsin how ihey participate in gene regulation.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
What are the differences between miRNA and siRNA?
(Select all that apply.)
OmiRNAs carry the genetic information from the DNA in
the nucleus directly to the cytoplasm, and siRNAs are
involved in the degradation of specific mRNA molecules.
miRNAs are from 22 to 30 bases long, and siRNAs are 22
bases long.
O miRNAs carry the genetic information from the DNA in
the nucleus directly to the cytoplasm, and siRNAs help
with the processing of the initial mRNA transcribed from
DNA into a mature form.
miRNAs prevent translation of certain mRNAs, and
siRNAs are involved in the degradation of specific mRNA
molecules.
miRNAs are 20 to 22 bases long, and siRNAs are from 20
to 30 bases long.
What are some similarities and differences between siRNAs and miRNAs?
Explain how the miR-200 family of miRNAs behave as tumorsuppressorgenes. What happens when their expression is blocked or decreased?
Chapter 18 Solutions
Campbell Biology: Custom Edition
Ch. 18.1 - How does binding of the trp corepressor to the trp...Ch. 18.1 - Describe the binding of RNA Polymerase,...Ch. 18.1 - WHAT IF? A certain mutation in E. coli changes...Ch. 18.2 - In general, what are the effects of histone...Ch. 18.2 - MAKE CONNECTIONS Speculate about whether the same...Ch. 18.2 - Compare the roles of general and specific...Ch. 18.2 - Once mRNA encoding a particular protein reaches...Ch. 18.2 - WHAT IF? Suppose you compared the nucleotide...Ch. 18.3 - Compare miRNAs and siRNAs, including their...Ch. 18.3 - WH AT IF? Suppose the mRNA being degraded in...
Ch. 18.3 - MAKE CONNECTIONS Inactivation of one of the X...Ch. 18.4 - MAKE CONNECTIONS As you learned in Chapter 12,...Ch. 18.4 - MAKE CONNECTIONS Explain how the signaling...Ch. 18.4 - How do fruit fly maternal effect genes determine...Ch. 18.4 - Prob. 4CCCh. 18.5 - Prob. 1CCCh. 18.5 - Under what circumstances is cancer considered to...Ch. 18.5 - MAKE CONNECTIONS The p53 protein can activate...Ch. 18 - Compare and contrast the roles of a corepressor...Ch. 18 - Describe what must happen in a cell for a gene...Ch. 18 - Why are miRNAs called noncoding RNAs? Explsin how...Ch. 18 - Describe the two main processes that cause...Ch. 18 - Compare the usual functions of proteins encoded by...Ch. 18 - If a particular operon encodes enzymes for making...Ch. 18 - Muscle cells differ from nerve cells mainly...Ch. 18 - The functioning of enhancers is an example of (A)...Ch. 18 - Cell differentiation always involves (A)...Ch. 18 - Which of the following is an example of...Ch. 18 - What would occur if the repressor of an inducible...Ch. 18 - Absence of bicoid in mRNA from a Drosophila egg...Ch. 18 - Which of the following statements about the DNA in...Ch. 18 - Within a cell, the amount of protein made using a...Ch. 18 - Prob. 10TYUCh. 18 - draw it The diagram below shows five genes,...Ch. 18 - Prob. 12TYUCh. 18 - Prob. 13TYUCh. 18 - SCIENCE. TECHNOLOGY, AND SOCIETY Trace amounts of...Ch. 18 - WRITE ABOUT A THEME: INTERACTIONS In a Short essay...Ch. 18 - SYNTHESIZE YOUR KNOWLEDGE The flashlight fish has...
Additional Science Textbook Solutions
Find more solutions based on key concepts
The correct term for production of offspring. Introduction: Reproduction is an important life process for most ...
Biology Illinois Edition (Glencoe Science)
Relative thickness of the myocardium in different chambers; the functional significance of those differences; a...
Anatomy & Physiology: The Unity of Form and Function
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Figure 1.18 In the example below, the scientific method is used to solve an everyday problem. Which part in the...
Concepts of Biology
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following sequence fragment of an mRNA. Which of the miRNAS below would be competent for gene silencing? 5'-AUGCAAGCAUUGGCCAAGCUU-3' 5'-AUGCAAGCAUUGGCCAAGCUU-3 5'-UACGUUCGUAACCGGUUCGAA-3' 5'-AAGCUUGGUUAAUGCUUGCAU-3' 5'-UUCGAACCAAUUACGAACGUA-3' 3'-UUCGAACCAAUUACGAACGUA-5 3'-AUGCAAGCAUUGGCCAAGCUU-5'arrow_forwardIs an entire chromosome made into an mRNA during transcription?arrow_forwardWhich of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the precedingarrow_forward
- What is the principal difference between the binding ofsiRNA and miRNA with mRNA?arrow_forwardmiRNAs target endogenous mRNAs in a sequence-specific manner. Explain, conceptually, how one might identify potential mRNA targets for a given miRNA if you only know the sequence of the miRNA and the sequence of all mRNAs in a cell or tissue of interest.arrow_forwardThe diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.arrow_forward
- What would be a possible result if a miRNA that perfectly complemented E3 ligase was successfully processed in the cell?arrow_forwardHow do sRNAs alter the translation of target mRNAs?arrow_forwardHow do the stop codons UAA, UAG, and UGA know to form? What if a protein stops synthesizing too early or too late?arrow_forward
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.arrow_forwardWhich mechanisms are used by miRNAs to regulate gene expression? O Targeted degradation of mRNAs O Targeted inhibition of mRNA translation O Both A and B ONeither A nor Barrow_forwardDescribe the cis-acting elements that control tissuespecific transcription of eukaryotic protein-encodinggenes.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY